Incidental Mutation 'R9211:Pacs1'
ID 698910
Institutional Source Beutler Lab
Gene Symbol Pacs1
Ensembl Gene ENSMUSG00000024855
Gene Name phosphofurin acidic cluster sorting protein 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9211 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 5133688-5273119 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 5139029 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 775 (V775E)
Ref Sequence ENSEMBL: ENSMUSP00000025786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025786]
AlphaFold Q8K212
Predicted Effect probably damaging
Transcript: ENSMUST00000025786
AA Change: V775E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025786
Gene: ENSMUSG00000024855
AA Change: V775E

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
low complexity region 27 46 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Pacs-1 546 958 2e-193 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik G T 1: 120,171,431 D85Y possibly damaging Het
Accs T C 2: 93,838,269 R315G probably damaging Het
Adam3 A C 8: 24,687,894 W668G probably benign Het
Adgrb2 T A 4: 129,992,406 V113E probably benign Het
Anapc4 C T 5: 52,850,652 T391I possibly damaging Het
Angpt2 C T 8: 18,698,062 G394D probably benign Het
Ankrd31 C G 13: 96,893,043 L1662V possibly damaging Het
Ankrd36 A G 11: 5,662,370 D1234G possibly damaging Het
Ankrd6 C T 4: 32,806,580 V558M probably damaging Het
Ankrd61 T A 5: 143,891,540 M206L probably benign Het
Arhgap33 C T 7: 30,523,598 G970R possibly damaging Het
Atf7 A G 15: 102,528,682 V115A unknown Het
Atp2c2 A T 8: 119,719,293 R65S probably benign Het
Atp8b5 T A 4: 43,367,960 M861K probably damaging Het
Bmi1 T C 2: 18,684,341 S279P probably benign Het
Bptf T G 11: 107,055,298 S2372R probably damaging Het
Cacnb2 A T 2: 14,874,497 I15L unknown Het
Card11 A G 5: 140,883,620 M807T probably benign Het
Ccdc175 A T 12: 72,106,684 D704E probably damaging Het
Cd300ld T A 11: 114,987,560 Y42F probably damaging Het
Cdh1 A T 8: 106,664,330 T693S probably benign Het
Clca4b T C 3: 144,932,453 Y16C possibly damaging Het
Col4a4 A G 1: 82,528,780 I273T unknown Het
Coro2b C A 9: 62,520,380 V9L probably benign Het
Crnkl1 T C 2: 145,932,853 D55G probably damaging Het
Dcps T A 9: 35,124,576 N338I probably damaging Het
Dusp2 A T 2: 127,337,391 H222L probably benign Het
Dync1li1 C A 9: 114,688,944 Y21* probably null Het
Efhb T G 17: 53,449,479 Q381H probably damaging Het
Elac2 A T 11: 64,979,038 probably benign Het
Etaa1 A G 11: 17,946,053 V688A possibly damaging Het
Fam109b A T 15: 82,341,026 probably benign Het
Fam120c C T X: 151,344,499 H84Y probably benign Het
Fbxl7 T A 15: 26,789,530 N37I probably damaging Het
Fndc3b A T 3: 27,468,937 W498R probably damaging Het
Galc G A 12: 98,207,440 A621V probably benign Het
Gch1 A T 14: 47,189,062 I69N probably damaging Het
Gdpd4 T C 7: 97,966,259 V97A possibly damaging Het
Hirip3 C T 7: 126,864,395 R485* probably null Het
Hmgcs2 C T 3: 98,297,432 T302I possibly damaging Het
Ing5 A T 1: 93,812,687 K137I possibly damaging Het
Kcnh8 T A 17: 52,839,208 Y375N probably damaging Het
Kdm3a C A 6: 71,596,690 W963L probably benign Het
Klra17 T G 6: 129,865,688 I216L possibly damaging Het
Kmt2e A G 5: 23,464,772 K86E possibly damaging Het
Krt42 T C 11: 100,265,041 N293S possibly damaging Het
Lrrc8d T A 5: 105,812,350 W209R probably damaging Het
Mettl23 C T 11: 116,843,643 P13S unknown Het
Ncln T C 10: 81,487,693 Y540C probably damaging Het
Neb C G 2: 52,245,348 G3250A probably damaging Het
Nebl A G 2: 17,388,690 probably null Het
Nqo2 A T 13: 33,972,416 T38S probably benign Het
Obscn A T 11: 59,135,867 I170N probably benign Het
Olfr1085 A T 2: 86,657,680 Y259* probably null Het
Olfr1186 A G 2: 88,525,826 D81G probably benign Het
Olfr1344 G T 7: 6,440,418 G173W probably damaging Het
Olfr313 A T 11: 58,817,883 N292Y probably damaging Het
Olfr478 C T 7: 108,031,591 V251I probably damaging Het
Olfr846 T A 9: 19,360,528 I276F possibly damaging Het
Pmfbp1 T C 8: 109,535,813 I713T probably benign Het
Pnmal2 A G 7: 16,945,664 D191G unknown Het
Polr1a T C 6: 71,966,537 I1252T probably damaging Het
Prss16 A T 13: 22,008,584 M110K probably benign Het
Pygo2 T C 3: 89,430,731 probably null Het
Rab5b C A 10: 128,683,194 probably null Het
Reln G T 5: 22,344,202 Y69* probably null Het
Rgs12 T A 5: 34,965,821 M316K probably damaging Het
Rmi2 T C 16: 10,839,879 C118R possibly damaging Het
Rnf223 T A 4: 156,132,377 C70S probably damaging Het
Rxrb T A 17: 34,036,652 F371Y probably damaging Het
Smurf2 T A 11: 106,868,637 S78C probably damaging Het
Sorbs1 A T 19: 40,344,354 probably null Het
Spag17 C T 3: 100,125,298 probably benign Het
Spidr T C 16: 16,053,455 H217R probably benign Het
Tiam2 T G 17: 3,448,454 V835G possibly damaging Het
Tm2d2 C T 8: 25,020,532 R136* probably null Het
Tnks C T 8: 34,849,335 D877N probably damaging Het
Tns1 A G 1: 73,917,789 L491P possibly damaging Het
Trps1 A G 15: 50,831,444 I485T probably damaging Het
Tubgcp5 A G 7: 55,806,583 S308G probably benign Het
Ugt8a T C 3: 125,867,481 H454R probably damaging Het
Usp32 G T 11: 85,022,733 T924K probably damaging Het
Vmn2r91 A T 17: 18,136,557 K829* probably null Het
Zfc3h1 T C 10: 115,412,423 F1146L possibly damaging Het
Zfp729a G T 13: 67,619,701 A803E probably benign Het
Zfp990 A G 4: 145,537,601 T390A probably damaging Het
Other mutations in Pacs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pacs1 APN 19 5153698 missense probably damaging 0.98
IGL01335:Pacs1 APN 19 5142632 missense probably damaging 1.00
IGL01717:Pacs1 APN 19 5167972 missense probably damaging 1.00
IGL02453:Pacs1 APN 19 5135005 missense probably damaging 1.00
IGL02887:Pacs1 APN 19 5135110 splice site probably benign
Batavian UTSW 19 5156413 missense possibly damaging 0.71
chicory UTSW 19 5139297 missense probably benign 0.33
endive UTSW 19 5272583 nonsense probably null
Escarole UTSW 19 5156356 critical splice donor site probably null
frisee UTSW 19 5136791 missense probably damaging 1.00
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0240:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R0316:Pacs1 UTSW 19 5135121 splice site silent
R0369:Pacs1 UTSW 19 5141698 missense probably damaging 1.00
R0443:Pacs1 UTSW 19 5272583 nonsense probably null
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0973:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R0974:Pacs1 UTSW 19 5143829 missense probably damaging 1.00
R1202:Pacs1 UTSW 19 5135237 missense probably damaging 1.00
R1672:Pacs1 UTSW 19 5152309 missense probably benign 0.00
R1689:Pacs1 UTSW 19 5272615 unclassified probably benign
R1842:Pacs1 UTSW 19 5155884 missense probably damaging 0.96
R1847:Pacs1 UTSW 19 5153714 missense probably damaging 0.99
R3884:Pacs1 UTSW 19 5155759 missense probably damaging 0.99
R4577:Pacs1 UTSW 19 5143833 nonsense probably null
R4630:Pacs1 UTSW 19 5156356 critical splice donor site probably null
R5029:Pacs1 UTSW 19 5142271 missense probably benign 0.03
R5198:Pacs1 UTSW 19 5139297 missense probably benign 0.33
R5223:Pacs1 UTSW 19 5145141 missense probably benign 0.00
R5464:Pacs1 UTSW 19 5147207 missense probably benign
R5695:Pacs1 UTSW 19 5136791 missense probably damaging 1.00
R6128:Pacs1 UTSW 19 5152372 splice site probably null
R6335:Pacs1 UTSW 19 5159977 missense probably damaging 1.00
R6802:Pacs1 UTSW 19 5152784 missense probably damaging 0.99
R6831:Pacs1 UTSW 19 5160795 missense probably damaging 1.00
R7071:Pacs1 UTSW 19 5156374 missense possibly damaging 0.69
R7200:Pacs1 UTSW 19 5156413 missense possibly damaging 0.71
R7248:Pacs1 UTSW 19 5138975 missense probably damaging 1.00
R7576:Pacs1 UTSW 19 5145120 missense probably benign 0.09
R7682:Pacs1 UTSW 19 5152699 missense probably damaging 0.99
R7715:Pacs1 UTSW 19 5141681 missense probably benign 0.01
R7738:Pacs1 UTSW 19 5152350 missense probably benign 0.11
R8339:Pacs1 UTSW 19 5142623 missense probably damaging 1.00
R8930:Pacs1 UTSW 19 5135002 missense probably damaging 1.00
R8932:Pacs1 UTSW 19 5135002 missense probably damaging 1.00
R9043:Pacs1 UTSW 19 5138936 missense probably benign 0.23
R9459:Pacs1 UTSW 19 5145070 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTCACCCAGCATGGCTATG -3'
(R):5'- TGAGTGAGACCATGCTTTCC -3'

Sequencing Primer
(F):5'- CTATGCTGGGCCAGGGTG -3'
(R):5'- AATTGGCTGCATGTGCTCAC -3'
Posted On 2022-02-07