Incidental Mutation 'R9212:Chd1'
ID 698964
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Name chromodomain helicase DNA binding protein 1
Synonyms 4930525N21Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9212 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 15925229-15992872 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 15950767 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 153 (S153A)
Ref Sequence ENSEMBL: ENSMUSP00000024627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
AlphaFold P40201
Predicted Effect possibly damaging
Transcript: ENSMUST00000024627
AA Change: S153A

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: S153A

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173311
AA Change: S153A

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: S153A

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Meta Mutation Damage Score 0.0805 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass T C 6: 23,075,767 (GRCm39) D790G probably damaging Het
Abcb4 C T 5: 9,005,591 (GRCm39) P1158L probably damaging Het
Actn3 T C 19: 4,914,565 (GRCm39) D521G probably benign Het
Adhfe1 A T 1: 9,637,036 (GRCm39) D396V possibly damaging Het
Arhgap28 A G 17: 68,162,430 (GRCm39) M639T probably benign Het
Asb18 T C 1: 89,880,447 (GRCm39) T453A probably benign Het
Asxl3 T C 18: 22,655,389 (GRCm39) I1133T probably benign Het
C2cd4b G A 9: 67,667,028 (GRCm39) R8H probably damaging Het
Ccdc91 A G 6: 147,508,398 (GRCm39) I375V unknown Het
Cdh24 T A 14: 54,878,679 (GRCm39) probably benign Het
Cfap57 T A 4: 118,436,649 (GRCm39) I916F possibly damaging Het
Cfap65 G A 1: 74,959,567 (GRCm39) T861I probably benign Het
Cit A T 5: 116,013,952 (GRCm39) I222F possibly damaging Het
Clip1 T A 5: 123,721,399 (GRCm39) K1165N probably damaging Het
Cln6 A G 9: 62,757,973 (GRCm39) H244R probably damaging Het
Col19a1 A T 1: 24,500,555 (GRCm39) probably null Het
Dhx57 T G 17: 80,576,338 (GRCm39) D584A probably damaging Het
Dnah14 G A 1: 181,628,852 (GRCm39) V4123M possibly damaging Het
Fam193a T C 5: 34,597,481 (GRCm39) V94A probably benign Het
Fzd6 A G 15: 38,898,289 (GRCm39) H543R probably damaging Het
Gad2 T A 2: 22,571,399 (GRCm39) C446S probably damaging Het
Gm29106 A G 1: 118,127,270 (GRCm39) R321G probably damaging Het
Gon4l T C 3: 88,803,730 (GRCm39) V1447A probably benign Het
Hus1b A C 13: 31,130,858 (GRCm39) I267S possibly damaging Het
Kifap3 C T 1: 163,610,600 (GRCm39) L27F probably damaging Het
Lancl2 A C 6: 57,714,673 (GRCm39) I431L probably benign Het
Ltbp2 G A 12: 84,839,824 (GRCm39) P1069S probably damaging Het
Mrgprb2 A T 7: 48,202,392 (GRCm39) V111D possibly damaging Het
Mta3 A T 17: 84,015,846 (GRCm39) N16I probably damaging Het
Npepps G T 11: 97,129,047 (GRCm39) A379E probably damaging Het
Nppc G T 1: 86,597,619 (GRCm39) Q50K possibly damaging Het
Or2a51 T A 6: 43,178,756 (GRCm39) Y59* probably null Het
Or5p54 C A 7: 107,554,017 (GRCm39) H56Q probably benign Het
Orc2 A G 1: 58,515,695 (GRCm39) L271P probably damaging Het
Papolg T C 11: 23,823,817 (GRCm39) T334A probably benign Het
Pikfyve T C 1: 65,291,719 (GRCm39) S1313P probably damaging Het
Ppp2r3d T C 9: 101,063,175 (GRCm39) T154A probably benign Het
Ptprz1 A G 6: 23,050,493 (GRCm39) M2254V probably damaging Het
Rabgap1 T C 2: 37,377,152 (GRCm39) V328A probably damaging Het
Rnf17 T C 14: 56,761,785 (GRCm39) V1616A probably damaging Het
Rph3a T A 5: 121,086,005 (GRCm39) H477L possibly damaging Het
Rttn T C 18: 89,064,286 (GRCm39) probably null Het
Ryr2 A C 13: 11,844,560 (GRCm39) I392S probably damaging Het
Sbsn A G 7: 30,452,427 (GRCm39) N481D probably benign Het
Sf3a3 G A 4: 124,621,921 (GRCm39) E354K possibly damaging Het
Slc15a2 A C 16: 36,602,053 (GRCm39) Y81* probably null Het
Slc5a2 C A 7: 127,867,939 (GRCm39) Q202K probably damaging Het
Spata31h1 T C 10: 82,118,979 (GRCm39) N4677S possibly damaging Het
Stxbp2 G C 8: 3,686,220 (GRCm39) K313N Het
Tbc1d2b A T 9: 90,087,183 (GRCm39) L932Q possibly damaging Het
Trim24 A T 6: 37,896,335 (GRCm39) Q264L probably benign Het
Tubgcp3 A G 8: 12,691,200 (GRCm39) V446A possibly damaging Het
Unc93b1 G A 19: 3,993,557 (GRCm39) R333Q probably damaging Het
Wdr24 T C 17: 26,043,472 (GRCm39) V98A probably benign Het
Wdr62 G A 7: 29,942,563 (GRCm39) S1015L probably damaging Het
Zfp280d A G 9: 72,269,789 (GRCm39) *975W probably null Het
Zfp317 A T 9: 19,558,442 (GRCm39) K219* probably null Het
Zfp974 A G 7: 27,610,052 (GRCm39) S558P possibly damaging Het
Zfp986 A G 4: 145,625,798 (GRCm39) K153E probably benign Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15,952,827 (GRCm39) missense probably benign 0.37
IGL01356:Chd1 APN 17 15,970,127 (GRCm39) missense probably damaging 1.00
IGL01369:Chd1 APN 17 15,975,259 (GRCm39) missense probably damaging 0.97
IGL01519:Chd1 APN 17 17,598,831 (GRCm39) missense probably damaging 1.00
IGL01604:Chd1 APN 17 15,990,359 (GRCm39) missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17,598,858 (GRCm39) missense probably damaging 1.00
IGL01721:Chd1 APN 17 15,990,430 (GRCm39) missense probably damaging 1.00
IGL01959:Chd1 APN 17 15,962,435 (GRCm39) missense probably damaging 1.00
IGL02367:Chd1 APN 17 17,610,315 (GRCm39) missense probably damaging 0.98
IGL02476:Chd1 APN 17 15,954,535 (GRCm39) missense probably damaging 1.00
IGL02756:Chd1 APN 17 15,951,069 (GRCm39) missense probably damaging 0.97
IGL02817:Chd1 APN 17 15,969,762 (GRCm39) missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15,990,560 (GRCm39) missense probably benign 0.22
IGL03108:Chd1 APN 17 15,945,543 (GRCm39) missense possibly damaging 0.70
Holly UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15,967,451 (GRCm39) missense probably damaging 1.00
R0053:Chd1 UTSW 17 15,967,451 (GRCm39) missense probably damaging 1.00
R0128:Chd1 UTSW 17 17,613,829 (GRCm39) missense probably damaging 1.00
R0197:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R0285:Chd1 UTSW 17 17,594,942 (GRCm39) splice site probably benign
R0326:Chd1 UTSW 17 15,988,830 (GRCm39) missense probably benign
R0326:Chd1 UTSW 17 15,988,828 (GRCm39) missense probably damaging 1.00
R0372:Chd1 UTSW 17 17,607,552 (GRCm39) missense probably benign 0.14
R0391:Chd1 UTSW 17 15,970,156 (GRCm39) missense probably damaging 1.00
R0486:Chd1 UTSW 17 15,954,604 (GRCm39) missense probably damaging 0.99
R0637:Chd1 UTSW 17 15,962,550 (GRCm39) missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15,978,523 (GRCm39) unclassified probably benign
R0701:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R0788:Chd1 UTSW 17 15,927,376 (GRCm39) missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15,990,503 (GRCm39) missense probably damaging 1.00
R0883:Chd1 UTSW 17 15,945,693 (GRCm39) missense probably benign
R1169:Chd1 UTSW 17 15,955,994 (GRCm39) missense probably damaging 1.00
R1218:Chd1 UTSW 17 15,945,574 (GRCm39) missense probably damaging 1.00
R1370:Chd1 UTSW 17 17,607,742 (GRCm39) missense probably benign 0.00
R1470:Chd1 UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15,946,545 (GRCm39) missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15,959,769 (GRCm39) missense probably damaging 0.99
R1752:Chd1 UTSW 17 15,963,494 (GRCm39) critical splice donor site probably null
R1759:Chd1 UTSW 17 17,607,533 (GRCm39) missense probably benign 0.00
R1767:Chd1 UTSW 17 15,990,565 (GRCm39) missense probably damaging 1.00
R1938:Chd1 UTSW 17 15,982,748 (GRCm39) missense probably benign 0.39
R2007:Chd1 UTSW 17 15,951,268 (GRCm39) missense probably damaging 1.00
R2069:Chd1 UTSW 17 15,962,556 (GRCm39) missense probably damaging 1.00
R3771:Chd1 UTSW 17 17,594,913 (GRCm39) missense probably damaging 1.00
R3773:Chd1 UTSW 17 17,594,913 (GRCm39) missense probably damaging 1.00
R3849:Chd1 UTSW 17 15,952,133 (GRCm39) missense probably damaging 1.00
R4241:Chd1 UTSW 17 15,990,289 (GRCm39) nonsense probably null
R4242:Chd1 UTSW 17 15,990,289 (GRCm39) nonsense probably null
R4354:Chd1 UTSW 17 17,610,263 (GRCm39) missense probably benign 0.23
R4468:Chd1 UTSW 17 15,980,657 (GRCm39) missense probably damaging 0.99
R4469:Chd1 UTSW 17 15,980,657 (GRCm39) missense probably damaging 0.99
R4731:Chd1 UTSW 17 17,598,079 (GRCm39) missense probably benign 0.36
R4824:Chd1 UTSW 17 15,953,386 (GRCm39) missense probably damaging 1.00
R4840:Chd1 UTSW 17 15,989,016 (GRCm39) missense probably damaging 1.00
R4840:Chd1 UTSW 17 15,989,015 (GRCm39) nonsense probably null
R4880:Chd1 UTSW 17 17,594,916 (GRCm39) missense probably damaging 1.00
R4960:Chd1 UTSW 17 15,962,493 (GRCm39) missense probably damaging 0.96
R5071:Chd1 UTSW 17 15,982,667 (GRCm39) missense probably benign
R5078:Chd1 UTSW 17 15,946,616 (GRCm39) missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15,948,460 (GRCm39) missense probably benign 0.25
R5268:Chd1 UTSW 17 15,956,005 (GRCm39) missense probably damaging 1.00
R5304:Chd1 UTSW 17 15,990,530 (GRCm39) missense possibly damaging 0.55
R5304:Chd1 UTSW 17 15,975,213 (GRCm39) missense probably benign 0.01
R5307:Chd1 UTSW 17 15,952,832 (GRCm39) missense probably damaging 1.00
R5458:Chd1 UTSW 17 15,958,811 (GRCm39) missense probably damaging 1.00
R5553:Chd1 UTSW 17 17,605,875 (GRCm39) missense probably benign 0.17
R5623:Chd1 UTSW 17 15,975,194 (GRCm39) missense probably damaging 1.00
R6022:Chd1 UTSW 17 17,598,035 (GRCm39) missense probably benign 0.39
R6137:Chd1 UTSW 17 15,978,950 (GRCm39) missense probably damaging 1.00
R6257:Chd1 UTSW 17 15,950,465 (GRCm39) splice site probably null
R6373:Chd1 UTSW 17 15,958,898 (GRCm39) missense probably damaging 1.00
R6458:Chd1 UTSW 17 15,950,864 (GRCm39) missense probably benign 0.01
R6476:Chd1 UTSW 17 17,601,250 (GRCm39) critical splice donor site probably null
R6508:Chd1 UTSW 17 15,958,895 (GRCm39) missense probably benign 0.31
R6553:Chd1 UTSW 17 15,945,692 (GRCm39) missense probably benign 0.00
R6745:Chd1 UTSW 17 17,607,429 (GRCm39) missense probably benign 0.08
R7107:Chd1 UTSW 17 15,981,628 (GRCm39) missense probably damaging 0.98
R7230:Chd1 UTSW 17 15,927,199 (GRCm39) splice site probably null
R7317:Chd1 UTSW 17 15,962,536 (GRCm39) missense possibly damaging 0.71
R7341:Chd1 UTSW 17 15,990,499 (GRCm39) missense probably damaging 0.99
R7421:Chd1 UTSW 17 15,969,660 (GRCm39) missense probably benign 0.03
R7704:Chd1 UTSW 17 15,987,737 (GRCm39) missense probably benign
R7763:Chd1 UTSW 17 15,953,303 (GRCm39) missense probably damaging 1.00
R8156:Chd1 UTSW 17 15,981,666 (GRCm39) missense probably benign
R8194:Chd1 UTSW 17 17,594,737 (GRCm39) start gained probably benign
R8261:Chd1 UTSW 17 17,607,804 (GRCm39) missense probably benign 0.02
R8338:Chd1 UTSW 17 15,990,242 (GRCm39) missense probably damaging 1.00
R8401:Chd1 UTSW 17 15,963,473 (GRCm39) missense probably damaging 1.00
R8411:Chd1 UTSW 17 15,982,711 (GRCm39) missense probably damaging 0.98
R9067:Chd1 UTSW 17 15,951,107 (GRCm39) missense possibly damaging 0.49
R9184:Chd1 UTSW 17 15,962,551 (GRCm39) missense possibly damaging 0.71
R9210:Chd1 UTSW 17 15,950,767 (GRCm39) missense possibly damaging 0.70
R9666:Chd1 UTSW 17 15,955,976 (GRCm39) missense probably damaging 1.00
R9673:Chd1 UTSW 17 15,989,023 (GRCm39) missense probably benign 0.24
Z1176:Chd1 UTSW 17 15,988,995 (GRCm39) missense probably damaging 1.00
Z1176:Chd1 UTSW 17 15,986,609 (GRCm39) missense probably damaging 0.98
Z1177:Chd1 UTSW 17 15,968,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCCAATAAAACTCTGGGG -3'
(R):5'- TCACATTGACGGTGGCTTGG -3'

Sequencing Primer
(F):5'- GCCAATAAAACTCTGGGGTTATAAG -3'
(R):5'- ATCCTCAGATGAATCAATCTGTCTC -3'
Posted On 2022-02-07