Mutagenetix > Incidental Mutation

Incidental Mutation 'R9212:Dhx57'

698967

Institutional Source

Beutler Lab

Gene Symbol

Dhx57

Ensembl Gene

ENSMUSG00000035051

Gene Name

DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57

Synonyms

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001163759.1, NM_198942.2; MGI:2147067

Essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R9212 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80238304-80290476 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 80268909 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 584 (D584A)

Ref Sequence

ENSEMBL: ENSMUSP00000083742 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038166] [ENSMUST00000086555]

AlphaFold

Q6P5D3

Predicted Effect

probably damaging
Transcript: ENSMUST00000038166
AA Change: D531A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041069
Gene: ENSMUSG00000035051
AA Change: D531A

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
UBA	129	166	1.04e-3	SMART
ZnF_C3H1	246	272	4.07e-6	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	381	390	N/A	INTRINSIC
low complexity region	423	432	N/A	INTRINSIC
DEXDc	490	678	1.27e-28	SMART
Blast:DEXDc	688	752	2e-28	BLAST
HELICc	810	918	3.22e-16	SMART
HA2	984	1074	1.64e-24	SMART
Pfam:OB_NTP_bind	1113	1262	1.5e-20	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000086555
AA Change: D584A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000083742
Gene: ENSMUSG00000035051
AA Change: D584A

Domain	Start	End	E-Value	Type
low complexity region	6	50	N/A	INTRINSIC
low complexity region	169	178	N/A	INTRINSIC
UBA	182	219	1.04e-3	SMART
ZnF_C3H1	299	325	4.07e-6	SMART
low complexity region	410	421	N/A	INTRINSIC
low complexity region	434	443	N/A	INTRINSIC
low complexity region	476	485	N/A	INTRINSIC
DEXDc	543	731	1.27e-28	SMART
Blast:DEXDc	741	805	1e-28	BLAST
HELICc	863	971	3.22e-16	SMART
HA2	1037	1127	1.64e-24	SMART
Pfam:OB_NTP_bind	1166	1315	8.5e-25	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (57/57)

Allele List at MGI

All alleles(25) : Gene trapped(25)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932415D10Rik	T	C	10: 82,283,145	N4677S	possibly damaging	Het
Aass	T	C	6: 23,075,768	D790G	probably damaging	Het
Abcb4	C	T	5: 8,955,591	P1158L	probably damaging	Het
Actn3	T	C	19: 4,864,537	D521G	probably benign	Het
Adhfe1	A	T	1: 9,566,811	D396V	possibly damaging	Het
Arhgap28	A	G	17: 67,855,435	M639T	probably benign	Het
Asb18	T	C	1: 89,952,725	T453A	probably benign	Het
Asxl3	T	C	18: 22,522,332	I1133T	probably benign	Het
C2cd4b	G	A	9: 67,759,746	R8H	probably damaging	Het
Ccdc91	A	G	6: 147,606,900	I375V	unknown	Het
Cdh24	T	A	14: 54,641,222		probably benign	Het
Cfap57	T	A	4: 118,579,452	I916F	possibly damaging	Het
Cfap65	G	A	1: 74,920,408	T861I	probably benign	Het
Chd1	T	G	17: 15,730,505	S153A	possibly damaging	Het
Cit	A	T	5: 115,875,893	I222F	possibly damaging	Het
Clip1	T	A	5: 123,583,336	K1165N	probably damaging	Het
Cln6	A	G	9: 62,850,691	H244R	probably damaging	Het
Col19a1	A	T	1: 24,461,474		probably null	Het
Dnah14	G	A	1: 181,801,287	V4123M	possibly damaging	Het
Fam193a	T	C	5: 34,440,137	V94A	probably benign	Het
Fzd6	A	G	15: 39,034,894	H543R	probably damaging	Het
Gad2	T	A	2: 22,681,387	C446S	probably damaging	Het
Gm29106	A	G	1: 118,199,540	R321G	probably damaging	Het
Gon4l	T	C	3: 88,896,423	V1447A	probably benign	Het
Hus1b	A	C	13: 30,946,875	I267S	possibly damaging	Het
Kifap3	C	T	1: 163,783,031	L27F	probably damaging	Het
Lancl2	A	C	6: 57,737,688	I431L	probably benign	Het
Ltbp2	G	A	12: 84,793,050	P1069S	probably damaging	Het
Mrgprb2	A	T	7: 48,552,644	V111D	possibly damaging	Het
Mta3	A	T	17: 83,708,417	N16I	probably damaging	Het
Npepps	G	T	11: 97,238,221	A379E	probably damaging	Het
Nppc	G	T	1: 86,669,897	Q50K	possibly damaging	Het
Olfr435	T	A	6: 43,201,822	Y59*	probably null	Het
Olfr474	C	A	7: 107,954,810	H56Q	probably benign	Het
Orc2	A	G	1: 58,476,536	L271P	probably damaging	Het
Papolg	T	C	11: 23,873,817	T334A	probably benign	Het
Pikfyve	T	C	1: 65,252,560	S1313P	probably damaging	Het
Ppp2r3a	T	C	9: 101,185,976	T154A	probably benign	Het
Ptprz1	A	G	6: 23,050,494	M2254V	probably damaging	Het
Rabgap1	T	C	2: 37,487,140	V328A	probably damaging	Het
Rnf17	T	C	14: 56,524,328	V1616A	probably damaging	Het
Rph3a	T	A	5: 120,947,942	H477L	possibly damaging	Het
Rttn	T	C	18: 89,046,162		probably null	Het
Ryr2	A	C	13: 11,829,674	I392S	probably damaging	Het
Sbsn	A	G	7: 30,753,002	N481D	probably benign	Het
Sf3a3	G	A	4: 124,728,128	E354K	possibly damaging	Het
Slc15a2	A	C	16: 36,781,691	Y81*	probably null	Het
Slc5a2	C	A	7: 128,268,767	Q202K	probably damaging	Het
Stxbp2	G	C	8: 3,636,220	K313N		Het
Tbc1d2b	A	T	9: 90,205,130	L932Q	possibly damaging	Het
Trim24	A	T	6: 37,919,400	Q264L	probably benign	Het
Tubgcp3	A	G	8: 12,641,200	V446A	possibly damaging	Het
Unc93b1	G	A	19: 3,943,557	R333Q	probably damaging	Het
Wdr24	T	C	17: 25,824,498	V98A	probably benign	Het
Wdr62	G	A	7: 30,243,138	S1015L	probably damaging	Het
Zfp280d	A	G	9: 72,362,507	*975W	probably null	Het
Zfp317	A	T	9: 19,647,146	K219*	probably null	Het
Zfp974	A	G	7: 27,910,627	S558P	possibly damaging	Het
Zfp986	A	G	4: 145,899,228	K153E	probably benign	Het

Other mutations in Dhx57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00642:Dhx57	APN	17	80274976	missense	probably benign	0.00
IGL00811:Dhx57	APN	17	80253243	missense	probably damaging	1.00
IGL01389:Dhx57	APN	17	80281223	missense	probably benign	0.28
IGL01468:Dhx57	APN	17	80255610	nonsense	probably null
IGL01908:Dhx57	APN	17	80251443	missense	probably damaging	1.00
IGL01965:Dhx57	APN	17	80268850	missense	probably damaging	1.00
IGL02147:Dhx57	APN	17	80260323	missense	possibly damaging	0.95
IGL02275:Dhx57	APN	17	80274839	missense	probably benign	0.13
IGL02349:Dhx57	APN	17	80255571	missense	probably damaging	1.00
IGL02405:Dhx57	APN	17	80255550	critical splice donor site	probably null
IGL02588:Dhx57	APN	17	80268871	missense	probably damaging	1.00
IGL02673:Dhx57	APN	17	80267545	missense	probably damaging	1.00
IGL02836:Dhx57	APN	17	80267549	missense	probably damaging	1.00
IGL02889:Dhx57	APN	17	80247152	missense	possibly damaging	0.90
IGL03085:Dhx57	APN	17	80258097	missense	possibly damaging	0.48
P0014:Dhx57	UTSW	17	80275191	missense	probably benign	0.00
PIT4377001:Dhx57	UTSW	17	80263975	missense	probably damaging	0.96
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0100:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R0129:Dhx57	UTSW	17	80238914	missense	probably damaging	1.00
R0200:Dhx57	UTSW	17	80251473	missense	probably damaging	1.00
R0309:Dhx57	UTSW	17	80274881	missense	probably damaging	1.00
R0375:Dhx57	UTSW	17	80258121	missense	probably damaging	1.00
R0396:Dhx57	UTSW	17	80274797	missense	probably benign	0.34
R0520:Dhx57	UTSW	17	80258175	missense	possibly damaging	0.95
R0554:Dhx57	UTSW	17	80260236	nonsense	probably null
R0661:Dhx57	UTSW	17	80268864	missense	probably damaging	1.00
R0883:Dhx57	UTSW	17	80270371	missense	probably damaging	1.00
R0900:Dhx57	UTSW	17	80275582	missense	probably benign
R0963:Dhx57	UTSW	17	80275527	missense	probably benign	0.01
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1469:Dhx57	UTSW	17	80254418	missense	probably damaging	1.00
R1660:Dhx57	UTSW	17	80245728	missense	possibly damaging	0.83
R1707:Dhx57	UTSW	17	80275226	missense	probably damaging	0.96
R1822:Dhx57	UTSW	17	80253085	critical splice donor site	probably null
R1853:Dhx57	UTSW	17	80274879	nonsense	probably null
R1942:Dhx57	UTSW	17	80265144	missense	probably damaging	1.00
R2043:Dhx57	UTSW	17	80253080	splice site	probably benign
R2106:Dhx57	UTSW	17	80275363	missense	probably damaging	1.00
R2127:Dhx57	UTSW	17	80273048	missense	probably damaging	1.00
R2183:Dhx57	UTSW	17	80275331	missense	probably benign	0.07
R2249:Dhx57	UTSW	17	80281234	missense	probably damaging	0.98
R2400:Dhx57	UTSW	17	80260416	missense	probably damaging	0.99
R2404:Dhx57	UTSW	17	80254304	missense	probably damaging	0.98
R2513:Dhx57	UTSW	17	80241949	splice site	probably null
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2869:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2870:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2871:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R2874:Dhx57	UTSW	17	80251376	missense	probably benign	0.22
R3819:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R3964:Dhx57	UTSW	17	80265112	nonsense	probably null
R4535:Dhx57	UTSW	17	80275082	missense	probably damaging	1.00
R4666:Dhx57	UTSW	17	80274961	missense	probably damaging	1.00
R4788:Dhx57	UTSW	17	80275331	missense	probably benign	0.01
R4822:Dhx57	UTSW	17	80242167	splice site	probably null
R4863:Dhx57	UTSW	17	80253111	missense	probably damaging	1.00
R4988:Dhx57	UTSW	17	80251398	missense	probably damaging	1.00
R5391:Dhx57	UTSW	17	80275081	missense	probably damaging	1.00
R5559:Dhx57	UTSW	17	80254379	missense	possibly damaging	0.53
R5644:Dhx57	UTSW	17	80238873	missense	possibly damaging	0.73
R5997:Dhx57	UTSW	17	80245806	missense	probably damaging	0.96
R6090:Dhx57	UTSW	17	80263946	critical splice donor site	probably null
R6177:Dhx57	UTSW	17	80272966	missense	possibly damaging	0.91
R6283:Dhx57	UTSW	17	80274805	missense	probably benign	0.00
R6802:Dhx57	UTSW	17	80275321	missense	probably benign	0.43
R6924:Dhx57	UTSW	17	80238815	missense	possibly damaging	0.71
R7151:Dhx57	UTSW	17	80273047	missense	probably damaging	1.00
R7386:Dhx57	UTSW	17	80267577	missense	possibly damaging	0.89
R7393:Dhx57	UTSW	17	80255571	missense	probably damaging	1.00
R7451:Dhx57	UTSW	17	80247113	missense	probably damaging	1.00
R7602:Dhx57	UTSW	17	80274861	missense	probably benign	0.06
R7733:Dhx57	UTSW	17	80265074	critical splice donor site	probably null
R7748:Dhx57	UTSW	17	80265117	missense	probably damaging	1.00
R7749:Dhx57	UTSW	17	80238858	missense	probably benign	0.04
R7772:Dhx57	UTSW	17	80273078	missense	possibly damaging	0.71
R8213:Dhx57	UTSW	17	80275156	missense	possibly damaging	0.82
R8370:Dhx57	UTSW	17	80245763	missense	probably damaging	1.00
R8371:Dhx57	UTSW	17	80275490	missense	probably benign	0.18
R8403:Dhx57	UTSW	17	80278289	missense	probably damaging	1.00
R8467:Dhx57	UTSW	17	80254424	missense	probably damaging	1.00
R8690:Dhx57	UTSW	17	80270365	critical splice donor site	probably benign
R9210:Dhx57	UTSW	17	80268909	missense	probably damaging	1.00
R9447:Dhx57	UTSW	17	80242094	missense	probably damaging	1.00
R9562:Dhx57	UTSW	17	80254388	missense	probably damaging	1.00
R9669:Dhx57	UTSW	17	80245701	missense	probably benign	0.09
R9717:Dhx57	UTSW	17	80275018	missense	probably damaging	1.00
Z1088:Dhx57	UTSW	17	80251348	missense	probably damaging	1.00
Z1176:Dhx57	UTSW	17	80245805	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGCAGAGCTTACACACCTTGAC -3'
(R):5'- CCTGGGGACTCCATAGGTAAAAG -3'

Sequencing Primer
(F):5'- GACACTTTCCAGCCGAATCTG -3'
(R):5'- GGTCCTGAGTTCAAATCCCAG -3'

Posted On

2022-02-07