Incidental Mutation 'R9212:Unc93b1'
ID 698971
Institutional Source Beutler Lab
Gene Symbol Unc93b1
Ensembl Gene ENSMUSG00000036908
Gene Name unc-93 homolog B1 (C. elegans)
Synonyms unc-93 homolog B, unc-93 related protein
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9212 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 3935186-3949340 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 3943557 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 333 (R333Q)
Ref Sequence ENSEMBL: ENSMUSP00000124272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162708] [ENSMUST00000165711]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000162708
AA Change: R333Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124272
Gene: ENSMUSG00000036908
AA Change: R333Q

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
Pfam:UNC-93 135 214 1.6e-8 PFAM
transmembrane domain 238 260 N/A INTRINSIC
transmembrane domain 306 328 N/A INTRINSIC
transmembrane domain 364 386 N/A INTRINSIC
transmembrane domain 396 418 N/A INTRINSIC
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
transmembrane domain 494 513 N/A INTRINSIC
transmembrane domain 518 535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165711
AA Change: R333Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128751
Gene: ENSMUSG00000036908
AA Change: R333Q

DomainStartEndE-ValueType
low complexity region 66 78 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
Pfam:UNC-93 135 214 5.1e-9 PFAM
transmembrane domain 243 265 N/A INTRINSIC
transmembrane domain 305 327 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in innate and adaptive immune response by regulating toll-like receptor signaling. The encoded protein traffics nucleotide sensing toll-like receptors to the endolysosome from the endoplasmic reticulum. Deficiency of the encoded protein has been associated with herpes simplex encephalitis. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice with a transmembrane domain point mutation have no overt phenotype but fail to mount a normal cytokine response and exhibit increased susceptibility to mouse cytomegalovirus, Lysteria monocytogenes and Staphlococcus aureus. Antigen presentation by MHC class I and II is impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,145 N4677S possibly damaging Het
Aass T C 6: 23,075,768 D790G probably damaging Het
Abcb4 C T 5: 8,955,591 P1158L probably damaging Het
Actn3 T C 19: 4,864,537 D521G probably benign Het
Adhfe1 A T 1: 9,566,811 D396V possibly damaging Het
Arhgap28 A G 17: 67,855,435 M639T probably benign Het
Asb18 T C 1: 89,952,725 T453A probably benign Het
Asxl3 T C 18: 22,522,332 I1133T probably benign Het
C2cd4b G A 9: 67,759,746 R8H probably damaging Het
Ccdc91 A G 6: 147,606,900 I375V unknown Het
Cdh24 T A 14: 54,641,222 probably benign Het
Cfap57 T A 4: 118,579,452 I916F possibly damaging Het
Cfap65 G A 1: 74,920,408 T861I probably benign Het
Chd1 T G 17: 15,730,505 S153A possibly damaging Het
Cit A T 5: 115,875,893 I222F possibly damaging Het
Clip1 T A 5: 123,583,336 K1165N probably damaging Het
Cln6 A G 9: 62,850,691 H244R probably damaging Het
Col19a1 A T 1: 24,461,474 probably null Het
Dhx57 T G 17: 80,268,909 D584A probably damaging Het
Dnah14 G A 1: 181,801,287 V4123M possibly damaging Het
Fam193a T C 5: 34,440,137 V94A probably benign Het
Fzd6 A G 15: 39,034,894 H543R probably damaging Het
Gad2 T A 2: 22,681,387 C446S probably damaging Het
Gm29106 A G 1: 118,199,540 R321G probably damaging Het
Gon4l T C 3: 88,896,423 V1447A probably benign Het
Hus1b A C 13: 30,946,875 I267S possibly damaging Het
Kifap3 C T 1: 163,783,031 L27F probably damaging Het
Lancl2 A C 6: 57,737,688 I431L probably benign Het
Ltbp2 G A 12: 84,793,050 P1069S probably damaging Het
Mrgprb2 A T 7: 48,552,644 V111D possibly damaging Het
Mta3 A T 17: 83,708,417 N16I probably damaging Het
Npepps G T 11: 97,238,221 A379E probably damaging Het
Nppc G T 1: 86,669,897 Q50K possibly damaging Het
Olfr435 T A 6: 43,201,822 Y59* probably null Het
Olfr474 C A 7: 107,954,810 H56Q probably benign Het
Orc2 A G 1: 58,476,536 L271P probably damaging Het
Papolg T C 11: 23,873,817 T334A probably benign Het
Pikfyve T C 1: 65,252,560 S1313P probably damaging Het
Ppp2r3a T C 9: 101,185,976 T154A probably benign Het
Ptprz1 A G 6: 23,050,494 M2254V probably damaging Het
Rabgap1 T C 2: 37,487,140 V328A probably damaging Het
Rnf17 T C 14: 56,524,328 V1616A probably damaging Het
Rph3a T A 5: 120,947,942 H477L possibly damaging Het
Rttn T C 18: 89,046,162 probably null Het
Ryr2 A C 13: 11,829,674 I392S probably damaging Het
Sbsn A G 7: 30,753,002 N481D probably benign Het
Sf3a3 G A 4: 124,728,128 E354K possibly damaging Het
Slc15a2 A C 16: 36,781,691 Y81* probably null Het
Slc5a2 C A 7: 128,268,767 Q202K probably damaging Het
Stxbp2 G C 8: 3,636,220 K313N Het
Tbc1d2b A T 9: 90,205,130 L932Q possibly damaging Het
Trim24 A T 6: 37,919,400 Q264L probably benign Het
Tubgcp3 A G 8: 12,641,200 V446A possibly damaging Het
Wdr24 T C 17: 25,824,498 V98A probably benign Het
Wdr62 G A 7: 30,243,138 S1015L probably damaging Het
Zfp280d A G 9: 72,362,507 *975W probably null Het
Zfp317 A T 9: 19,647,146 K219* probably null Het
Zfp974 A G 7: 27,910,627 S558P possibly damaging Het
Zfp986 A G 4: 145,899,228 K153E probably benign Het
Other mutations in Unc93b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Unc93b1 APN 19 3935356 splice site probably null
IGL02631:Unc93b1 APN 19 3942026 splice site probably benign
IGL02942:Unc93b1 APN 19 3948686 missense probably damaging 1.00
IGL03149:Unc93b1 APN 19 3944041 missense probably benign
3d UTSW 19 3944168 missense possibly damaging 0.96
novelty UTSW 19 3943632 missense probably damaging 1.00
speciality UTSW 19 3941910 missense possibly damaging 0.51
R0680:Unc93b1 UTSW 19 3947093 missense probably benign
R1237:Unc93b1 UTSW 19 3935228 missense possibly damaging 0.72
R1557:Unc93b1 UTSW 19 3942403 missense probably benign 0.13
R1992:Unc93b1 UTSW 19 3944062 missense probably benign 0.00
R2435:Unc93b1 UTSW 19 3936373 missense possibly damaging 0.89
R4016:Unc93b1 UTSW 19 3943572 missense probably damaging 1.00
R4080:Unc93b1 UTSW 19 3941959 missense probably damaging 0.99
R4479:Unc93b1 UTSW 19 3935236 missense probably benign 0.16
R4829:Unc93b1 UTSW 19 3944293 missense probably damaging 1.00
R4947:Unc93b1 UTSW 19 3935871 missense probably benign 0.05
R4964:Unc93b1 UTSW 19 3942023 splice site probably null
R4966:Unc93b1 UTSW 19 3942023 splice site probably null
R5056:Unc93b1 UTSW 19 3942762 missense possibly damaging 0.45
R5166:Unc93b1 UTSW 19 3944027 missense probably damaging 1.00
R5441:Unc93b1 UTSW 19 3943703 missense probably benign 0.01
R5892:Unc93b1 UTSW 19 3943632 missense probably damaging 1.00
R6382:Unc93b1 UTSW 19 3935297 missense probably benign 0.19
R6556:Unc93b1 UTSW 19 3944105 missense probably benign
R6962:Unc93b1 UTSW 19 3936303 missense possibly damaging 0.57
R7143:Unc93b1 UTSW 19 3935204 missense unknown
R7748:Unc93b1 UTSW 19 3935250 missense unknown
R7866:Unc93b1 UTSW 19 3935243 missense not run
R8198:Unc93b1 UTSW 19 3941910 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- GGGACTGCAGCTCACTTTTCTG -3'
(R):5'- TTGTCTGTTCTTACCAGGGC -3'

Sequencing Primer
(F):5'- CTGGAACTCTCTATGTAGACCAGG -3'
(R):5'- GTCTGTTCTTACCAGGGCAAAAC -3'
Posted On 2022-02-07