Incidental Mutation 'R9214:Ccdc187'
ID 699040
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Name coiled-coil domain containing 187
Synonyms 4932418E24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock # R9214 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 26243469-26294557 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 26293397 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 197 (T197K)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
AlphaFold Q8C5V8
Predicted Effect probably benign
Transcript: ENSMUST00000057224
AA Change: T197K

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: T197K

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: T197K
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: T197K
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,983,369 D352G probably benign Het
4933416C03Rik T C 10: 116,112,998 T208A probably benign Het
5430419D17Rik C T 7: 131,222,752 S192L possibly damaging Het
Abi1 A T 2: 22,941,977 Y447* probably null Het
Acot1 A G 12: 84,017,415 Y124C Het
Adgrf4 T C 17: 42,667,813 N213S possibly damaging Het
Alg9 T A 9: 50,806,245 Y443N probably damaging Het
Bhlhe22 A G 3: 18,054,860 T25A probably benign Het
Bpifa1 C A 2: 154,143,869 P35T unknown Het
Btbd16 T C 7: 130,779,707 probably null Het
Cd209b A G 8: 3,918,771 V295A probably benign Het
Clrn2 G T 5: 45,460,176 A130S probably benign Het
Cnrip1 A G 11: 17,054,740 T97A probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cyfip1 T A 7: 55,873,525 probably null Het
Ddx1 A G 12: 13,236,118 S278P probably benign Het
Dnah12 A C 14: 26,723,905 E654D probably benign Het
Efcab7 T C 4: 99,878,235 S154P probably damaging Het
Emcn T C 3: 137,341,268 F10S probably damaging Het
Fam160b1 A G 19: 57,385,324 H672R probably damaging Het
Flg2 G T 3: 93,203,577 A971S unknown Het
Gli2 A T 1: 118,868,061 H121Q probably damaging Het
Gm3633 A G 14: 42,638,402 probably benign Het
Gm4869 G A 5: 140,482,502 R649Q probably benign Het
Gm9573 T A 17: 35,620,946 S783C unknown Het
Golga2 T C 2: 32,305,810 L846P probably damaging Het
Golga7b A T 19: 42,267,001 I106F probably damaging Het
Hltf T C 3: 20,086,116 S460P probably benign Het
Hyal5 A G 6: 24,876,404 Y92C probably damaging Het
Mapk1 T A 16: 17,035,685 C84S probably benign Het
March10 A G 11: 105,390,274 V395A probably benign Het
Meltf A G 16: 31,878,945 T7A probably benign Het
Mfhas1 T A 8: 35,590,576 V735D probably damaging Het
Mia2 G T 12: 59,176,364 R486L possibly damaging Het
Mmp20 T C 9: 7,628,326 L25P probably benign Het
Mprip C T 11: 59,760,075 T1535I possibly damaging Het
Mrpl9 T A 3: 94,447,819 S233T possibly damaging Het
Nckap5 A C 1: 126,014,639 V1576G probably benign Het
Ntng1 T C 3: 109,934,605 Y284C probably damaging Het
Numa1 T A 7: 102,000,932 V1290D probably damaging Het
Olfr685 T G 7: 105,180,380 Y326S probably benign Het
Pcdhgc4 A T 18: 37,817,211 D560V probably damaging Het
Pla2g1b A G 5: 115,472,048 K84E possibly damaging Het
Pramef25 T C 4: 143,949,180 I359V probably benign Het
Prrt4 C T 6: 29,170,768 A562T possibly damaging Het
Rab6a T C 7: 100,626,579 F33S probably damaging Het
Rgs11 A G 17: 26,208,286 Y397C probably damaging Het
Rnf43 A T 11: 87,731,285 H277L probably benign Het
Ryr1 A G 7: 29,085,762 S1842P possibly damaging Het
Slc25a34 C T 4: 141,623,330 A123T probably damaging Het
Smoc2 A G 17: 14,336,577 Y96C probably damaging Het
Sqle A G 15: 59,322,916 E267G probably benign Het
Sspo G A 6: 48,463,935 R1777H possibly damaging Het
Stx6 T A 1: 155,191,464 N133K probably benign Het
Thoc5 A T 11: 4,914,303 Q320L probably benign Het
Tmc4 G C 7: 3,667,498 C531W probably damaging Het
Tmigd1 A G 11: 76,910,205 T173A probably damaging Het
Tpp2 A C 1: 43,992,354 M1111L probably benign Het
Ttc21a T C 9: 119,943,875 V206A probably benign Het
Ulk1 A T 5: 110,788,797 V758E possibly damaging Het
Vdr T A 15: 97,869,719 H130L probably benign Het
Vps13b A G 15: 35,623,746 T1270A probably damaging Het
Zc3h13 A G 14: 75,323,551 D527G unknown Het
Zfp512 C T 5: 31,480,090 R508W probably damaging Het
Zfp606 A G 7: 12,481,099 T85A unknown Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26280948 missense probably benign
IGL02989:Ccdc187 APN 2 26276431 missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26280966 missense probably benign
IGL03059:Ccdc187 APN 2 26294241 missense probably null 1.00
IGL03117:Ccdc187 APN 2 26287968 missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26281353 missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R1078:Ccdc187 UTSW 2 26294377 missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26276121 missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26281075 missense probably benign
R1733:Ccdc187 UTSW 2 26293658 missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26276068 missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26281017 missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26282227 intron probably benign
R4344:Ccdc187 UTSW 2 26280669 missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26293439 missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26276225 missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26276092 missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26293368 missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26293581 missense probably benign
R6261:Ccdc187 UTSW 2 26276203 missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26289779 missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26289734 missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26289719 missense probably benign
R7006:Ccdc187 UTSW 2 26281090 missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26255995 missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26276174 missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26293514 missense possibly damaging 0.53
R8327:Ccdc187 UTSW 2 26280618 missense probably benign 0.01
R8353:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8425:Ccdc187 UTSW 2 26281536 missense probably damaging 0.99
R8453:Ccdc187 UTSW 2 26276446 missense probably damaging 0.99
R8461:Ccdc187 UTSW 2 26293802 missense probably damaging 0.99
R8534:Ccdc187 UTSW 2 26275565 missense possibly damaging 0.61
R8694:Ccdc187 UTSW 2 26275493 missense probably benign 0.02
R8745:Ccdc187 UTSW 2 26280514 missense probably damaging 0.99
R8958:Ccdc187 UTSW 2 26275565 missense probably benign 0.02
R8972:Ccdc187 UTSW 2 26281067 missense probably benign
R9454:Ccdc187 UTSW 2 26276102 missense possibly damaging 0.94
Z1176:Ccdc187 UTSW 2 26281507 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCATCTTCACCCTAAATTCAGCTC -3'
(R):5'- TTTCTCATGGGCCCTGGAAG -3'

Sequencing Primer
(F):5'- TCTTCACCCTAAATTCAGCTCAGAAG -3'
(R):5'- GGAAAGGCCACCCCTGATACTG -3'
Posted On 2022-02-07