Incidental Mutation 'R9214:Alg9'
ID 699073
Institutional Source Beutler Lab
Gene Symbol Alg9
Ensembl Gene ENSMUSG00000032059
Gene Name asparagine-linked glycosylation 9 (alpha 1,2 mannosyltransferase)
Synonyms B430313H07Rik, 8230402H15Rik, Dibd1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9214 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 50775019-50843542 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 50806245 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 443 (Y443N)
Ref Sequence ENSEMBL: ENSMUSP00000034561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034561] [ENSMUST00000162073] [ENSMUST00000177320]
AlphaFold Q8VDI9
Predicted Effect probably damaging
Transcript: ENSMUST00000034561
AA Change: Y443N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034561
Gene: ENSMUSG00000032059
AA Change: Y443N

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 482 3.5e-127 PFAM
low complexity region 598 611 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162073
SMART Domains Protein: ENSMUSP00000125425
Gene: ENSMUSG00000032059

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 60 167 7.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175728
Predicted Effect probably damaging
Transcript: ENSMUST00000177320
AA Change: Y60N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134818
Gene: ENSMUSG00000032059
AA Change: Y60N

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 2 99 4.3e-15 PFAM
Meta Mutation Damage Score 0.9175 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha-1,2-mannosyltransferase enzyme that functions in lipid-linked oligosaccharide assembly. Mutations in this gene result in congenital disorder of glycosylation type Il. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,983,369 D352G probably benign Het
4933416C03Rik T C 10: 116,112,998 T208A probably benign Het
5430419D17Rik C T 7: 131,222,752 S192L possibly damaging Het
Abi1 A T 2: 22,941,977 Y447* probably null Het
Acot1 A G 12: 84,017,415 Y124C Het
Adgrf4 T C 17: 42,667,813 N213S possibly damaging Het
Bhlhe22 A G 3: 18,054,860 T25A probably benign Het
Bpifa1 C A 2: 154,143,869 P35T unknown Het
Btbd16 T C 7: 130,779,707 probably null Het
Ccdc187 G T 2: 26,293,397 T197K probably benign Het
Cd209b A G 8: 3,918,771 V295A probably benign Het
Clrn2 G T 5: 45,460,176 A130S probably benign Het
Cnrip1 A G 11: 17,054,740 T97A probably damaging Het
Col15a1 G C 4: 47,288,200 probably benign Het
Col6a5 T C 9: 105,881,741 T2089A possibly damaging Het
Cyfip1 T A 7: 55,873,525 probably null Het
Ddx1 A G 12: 13,236,118 S278P probably benign Het
Dnah12 A C 14: 26,723,905 E654D probably benign Het
Efcab7 T C 4: 99,878,235 S154P probably damaging Het
Emcn T C 3: 137,341,268 F10S probably damaging Het
Fam160b1 A G 19: 57,385,324 H672R probably damaging Het
Flg2 G T 3: 93,203,577 A971S unknown Het
Gli2 A T 1: 118,868,061 H121Q probably damaging Het
Gm3633 A G 14: 42,638,402 probably benign Het
Gm4869 G A 5: 140,482,502 R649Q probably benign Het
Gm9573 T A 17: 35,620,946 S783C unknown Het
Golga2 T C 2: 32,305,810 L846P probably damaging Het
Golga7b A T 19: 42,267,001 I106F probably damaging Het
Hltf T C 3: 20,086,116 S460P probably benign Het
Hyal5 A G 6: 24,876,404 Y92C probably damaging Het
Mapk1 T A 16: 17,035,685 C84S probably benign Het
March10 A G 11: 105,390,274 V395A probably benign Het
Meltf A G 16: 31,878,945 T7A probably benign Het
Mfhas1 T A 8: 35,590,576 V735D probably damaging Het
Mia2 G T 12: 59,176,364 R486L possibly damaging Het
Mmp20 T C 9: 7,628,326 L25P probably benign Het
Mprip C T 11: 59,760,075 T1535I possibly damaging Het
Mrpl9 T A 3: 94,447,819 S233T possibly damaging Het
Nckap5 A C 1: 126,014,639 V1576G probably benign Het
Ntng1 T C 3: 109,934,605 Y284C probably damaging Het
Numa1 T A 7: 102,000,932 V1290D probably damaging Het
Olfr685 T G 7: 105,180,380 Y326S probably benign Het
Pcdhgc4 A T 18: 37,817,211 D560V probably damaging Het
Pla2g1b A G 5: 115,472,048 K84E possibly damaging Het
Pramef25 T C 4: 143,949,180 I359V probably benign Het
Prrt4 C T 6: 29,170,768 A562T possibly damaging Het
Rab6a T C 7: 100,626,579 F33S probably damaging Het
Rgs11 A G 17: 26,208,286 Y397C probably damaging Het
Rnf43 A T 11: 87,731,285 H277L probably benign Het
Ryr1 A G 7: 29,085,762 S1842P possibly damaging Het
Slc25a34 C T 4: 141,623,330 A123T probably damaging Het
Smoc2 A G 17: 14,336,577 Y96C probably damaging Het
Sqle A G 15: 59,322,916 E267G probably benign Het
Sspo G A 6: 48,463,935 R1777H possibly damaging Het
Stx6 T A 1: 155,191,464 N133K probably benign Het
Thoc5 A T 11: 4,914,303 Q320L probably benign Het
Tmc4 G C 7: 3,667,498 C531W probably damaging Het
Tmigd1 A G 11: 76,910,205 T173A probably damaging Het
Tpp2 A C 1: 43,992,354 M1111L probably benign Het
Ttc21a T C 9: 119,943,875 V206A probably benign Het
Ulk1 A T 5: 110,788,797 V758E possibly damaging Het
Vdr T A 15: 97,869,719 H130L probably benign Het
Vps13b A G 15: 35,623,746 T1270A probably damaging Het
Zc3h13 A G 14: 75,323,551 D527G unknown Het
Zfp512 C T 5: 31,480,090 R508W probably damaging Het
Zfp606 A G 7: 12,481,099 T85A unknown Het
Other mutations in Alg9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Alg9 APN 9 50775377 splice site probably null
IGL02792:Alg9 APN 9 50842748 missense possibly damaging 0.90
gum_drop UTSW 9 50805354 missense possibly damaging 0.90
FR4976:Alg9 UTSW 9 50775431 unclassified probably benign
R1183:Alg9 UTSW 9 50789533 missense possibly damaging 0.82
R1270:Alg9 UTSW 9 50787572 intron probably benign
R1575:Alg9 UTSW 9 50775502 missense possibly damaging 0.65
R1773:Alg9 UTSW 9 50779096 missense probably benign 0.30
R1837:Alg9 UTSW 9 50806315 missense probably damaging 1.00
R2011:Alg9 UTSW 9 50788200 missense probably damaging 1.00
R4324:Alg9 UTSW 9 50805343 missense probably damaging 1.00
R4514:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4544:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4546:Alg9 UTSW 9 50805354 missense possibly damaging 0.90
R4996:Alg9 UTSW 9 50808705 missense probably damaging 1.00
R5007:Alg9 UTSW 9 50788224 missense probably damaging 1.00
R5053:Alg9 UTSW 9 50788172 missense probably damaging 1.00
R5308:Alg9 UTSW 9 50822711 missense possibly damaging 0.95
R6803:Alg9 UTSW 9 50789560 missense probably benign 0.37
R6994:Alg9 UTSW 9 50792122 nonsense probably null
R6998:Alg9 UTSW 9 50789621 missense possibly damaging 0.95
R7298:Alg9 UTSW 9 50779061 missense probably damaging 0.97
R7480:Alg9 UTSW 9 50822628 missense probably benign 0.06
R7561:Alg9 UTSW 9 50842774 missense possibly damaging 0.95
R7578:Alg9 UTSW 9 50789535 missense probably benign
R7721:Alg9 UTSW 9 50776642 missense probably damaging 0.99
R7829:Alg9 UTSW 9 50788171 missense probably damaging 1.00
R7847:Alg9 UTSW 9 50789605 missense possibly damaging 0.62
R7878:Alg9 UTSW 9 50842783 missense probably benign 0.00
R8113:Alg9 UTSW 9 50808780 nonsense probably null
R8257:Alg9 UTSW 9 50779087 missense possibly damaging 0.62
R9497:Alg9 UTSW 9 50800136 missense probably damaging 0.97
R9511:Alg9 UTSW 9 50806225 missense probably damaging 1.00
RF003:Alg9 UTSW 9 50775427 unclassified probably benign
RF006:Alg9 UTSW 9 50775417 unclassified probably benign
RF058:Alg9 UTSW 9 50775427 unclassified probably benign
Z1177:Alg9 UTSW 9 50788173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGTTATATTTGGCGAAGTGAAG -3'
(R):5'- TGAGAGAGGAGAGCCATTTCC -3'

Sequencing Primer
(F):5'- AAGTGGTGGTAGAGTCGGCTTC -3'
(R):5'- AGAGGAGAGCCATTTCCTTTTTATGC -3'
Posted On 2022-02-07