Incidental Mutation 'R9214:Smoc2'
ID 699095
Institutional Source Beutler Lab
Gene Symbol Smoc2
Ensembl Gene ENSMUSG00000023886
Gene Name SPARC related modular calcium binding 2
Synonyms 5430426J21Rik, 1700056C05Rik, Smoc2l
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9214 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 14499768-14625052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14556839 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 96 (Y96C)
Ref Sequence ENSEMBL: ENSMUSP00000024660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024660]
AlphaFold Q8CD91
Predicted Effect probably damaging
Transcript: ENSMUST00000024660
AA Change: Y96C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024660
Gene: ENSMUSG00000023886
AA Change: Y96C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 39 84 1.49e-12 SMART
TY 110 157 3.07e-14 SMART
low complexity region 166 177 N/A INTRINSIC
TY 237 285 3.34e-15 SMART
Pfam:SPARC_Ca_bdg 302 412 8.6e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPARC family (secreted protein acidic and rich in cysteine/osteonectin/BM-40), which are highly expressed during embryogenesis and wound healing. The gene product is a matricellular protein which promotes matrix assembly and can stimulate endothelial cell proliferation and migration, as well as angiogenic activity. Associated with pulmonary function, this secretory gene product contains a Kazal domain, two thymoglobulin type-1 domains, and two EF-hand calcium-binding domains. The encoded protein may serve as a target for controlling angiogenesis in tumor growth and myocardial ischemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for one KO allele exhibit protection from induced kidney fibrosis and reduced interstitial myofibroblast accumulation. Another KO allele leads to shortening and widening of the skull. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik T C 9: 55,890,653 (GRCm39) D352G probably benign Het
Abi1 A T 2: 22,831,989 (GRCm39) Y447* probably null Het
Acot1 A G 12: 84,064,189 (GRCm39) Y124C Het
Adgrf4 T C 17: 42,978,704 (GRCm39) N213S possibly damaging Het
Alg9 T A 9: 50,717,545 (GRCm39) Y443N probably damaging Het
Bhlhe22 A G 3: 18,109,024 (GRCm39) T25A probably benign Het
Bpifa1 C A 2: 153,985,789 (GRCm39) P35T unknown Het
Btbd16 T C 7: 130,381,437 (GRCm39) probably null Het
Ccdc187 G T 2: 26,183,409 (GRCm39) T197K probably benign Het
Cd209b A G 8: 3,968,771 (GRCm39) V295A probably benign Het
Cdcp3 C T 7: 130,824,481 (GRCm39) S192L possibly damaging Het
Clrn2 G T 5: 45,617,518 (GRCm39) A130S probably benign Het
Cnrip1 A G 11: 17,004,740 (GRCm39) T97A probably damaging Het
Col15a1 G C 4: 47,288,200 (GRCm39) probably benign Het
Col6a5 T C 9: 105,758,940 (GRCm39) T2089A possibly damaging Het
Cyfip1 T A 7: 55,523,273 (GRCm39) probably null Het
Ddx1 A G 12: 13,286,119 (GRCm39) S278P probably benign Het
Dnah12 A C 14: 26,445,060 (GRCm39) E654D probably benign Het
Efcab7 T C 4: 99,735,437 (GRCm39) S154P probably damaging Het
Emcn T C 3: 137,047,029 (GRCm39) F10S probably damaging Het
Fhip2a A G 19: 57,373,756 (GRCm39) H672R probably damaging Het
Flg2 G T 3: 93,110,884 (GRCm39) A971S unknown Het
Gli2 A T 1: 118,795,791 (GRCm39) H121Q probably damaging Het
Gm3633 A G 14: 42,460,359 (GRCm39) probably benign Het
Golga2 T C 2: 32,195,822 (GRCm39) L846P probably damaging Het
Golga7b A T 19: 42,255,440 (GRCm39) I106F probably damaging Het
Hltf T C 3: 20,140,280 (GRCm39) S460P probably benign Het
Hyal5 A G 6: 24,876,403 (GRCm39) Y92C probably damaging Het
Kif19b G A 5: 140,468,257 (GRCm39) R649Q probably benign Het
Mapk1 T A 16: 16,853,549 (GRCm39) C84S probably benign Het
Marchf10 A G 11: 105,281,100 (GRCm39) V395A probably benign Het
Meltf A G 16: 31,697,763 (GRCm39) T7A probably benign Het
Mfhas1 T A 8: 36,057,730 (GRCm39) V735D probably damaging Het
Mia2 G T 12: 59,223,150 (GRCm39) R486L possibly damaging Het
Mmp20 T C 9: 7,628,327 (GRCm39) L25P probably benign Het
Mprip C T 11: 59,650,901 (GRCm39) T1535I possibly damaging Het
Mrpl9 T A 3: 94,355,126 (GRCm39) S233T possibly damaging Het
Muc21 T A 17: 35,931,838 (GRCm39) S783C unknown Het
Nckap5 A C 1: 125,942,376 (GRCm39) V1576G probably benign Het
Ntng1 T C 3: 109,841,921 (GRCm39) Y284C probably damaging Het
Numa1 T A 7: 101,650,139 (GRCm39) V1290D probably damaging Het
Or52l1 T G 7: 104,829,587 (GRCm39) Y326S probably benign Het
Pcdhgc4 A T 18: 37,950,264 (GRCm39) D560V probably damaging Het
Pla2g1b A G 5: 115,610,107 (GRCm39) K84E possibly damaging Het
Pramel16 T C 4: 143,675,750 (GRCm39) I359V probably benign Het
Prrt4 C T 6: 29,170,767 (GRCm39) A562T possibly damaging Het
Rab6a T C 7: 100,275,786 (GRCm39) F33S probably damaging Het
Rgs11 A G 17: 26,427,260 (GRCm39) Y397C probably damaging Het
Rnf43 A T 11: 87,622,111 (GRCm39) H277L probably benign Het
Ryr1 A G 7: 28,785,187 (GRCm39) S1842P possibly damaging Het
Slc25a34 C T 4: 141,350,641 (GRCm39) A123T probably damaging Het
Sqle A G 15: 59,194,765 (GRCm39) E267G probably benign Het
Sspo G A 6: 48,440,869 (GRCm39) R1777H possibly damaging Het
Stx6 T A 1: 155,067,210 (GRCm39) N133K probably benign Het
Taf7l2 T C 10: 115,948,903 (GRCm39) T208A probably benign Het
Thoc5 A T 11: 4,864,303 (GRCm39) Q320L probably benign Het
Tmc4 G C 7: 3,670,497 (GRCm39) C531W probably damaging Het
Tmigd1 A G 11: 76,801,031 (GRCm39) T173A probably damaging Het
Tpp2 A C 1: 44,031,514 (GRCm39) M1111L probably benign Het
Ttc21a T C 9: 119,772,941 (GRCm39) V206A probably benign Het
Ulk1 A T 5: 110,936,663 (GRCm39) V758E possibly damaging Het
Vdr T A 15: 97,767,600 (GRCm39) H130L probably benign Het
Vps13b A G 15: 35,623,892 (GRCm39) T1270A probably damaging Het
Zc3h13 A G 14: 75,560,991 (GRCm39) D527G unknown Het
Zfp512 C T 5: 31,637,434 (GRCm39) R508W probably damaging Het
Zfp606 A G 7: 12,215,026 (GRCm39) T85A unknown Het
Other mutations in Smoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Smoc2 APN 17 14,545,876 (GRCm39) missense probably damaging 1.00
IGL02085:Smoc2 APN 17 14,567,495 (GRCm39) missense possibly damaging 0.79
IGL02309:Smoc2 APN 17 14,595,789 (GRCm39) splice site probably benign
IGL02975:Smoc2 APN 17 14,556,872 (GRCm39) missense probably damaging 0.98
enamel UTSW 17 14,545,896 (GRCm39) missense probably damaging 1.00
FR4976:Smoc2 UTSW 17 14,621,824 (GRCm39) small deletion probably benign
R2291:Smoc2 UTSW 17 14,589,233 (GRCm39) missense possibly damaging 0.53
R2343:Smoc2 UTSW 17 14,564,604 (GRCm39) missense probably benign 0.22
R2888:Smoc2 UTSW 17 14,617,887 (GRCm39) critical splice donor site probably null
R3878:Smoc2 UTSW 17 14,545,879 (GRCm39) missense probably damaging 1.00
R4872:Smoc2 UTSW 17 14,589,295 (GRCm39) missense probably benign 0.12
R5153:Smoc2 UTSW 17 14,556,841 (GRCm39) missense probably damaging 1.00
R5175:Smoc2 UTSW 17 14,595,719 (GRCm39) missense possibly damaging 0.89
R5239:Smoc2 UTSW 17 14,589,227 (GRCm39) missense probably benign 0.19
R5292:Smoc2 UTSW 17 14,556,835 (GRCm39) missense probably damaging 0.98
R5794:Smoc2 UTSW 17 14,589,310 (GRCm39) missense possibly damaging 0.94
R7810:Smoc2 UTSW 17 14,545,884 (GRCm39) missense probably damaging 1.00
R7996:Smoc2 UTSW 17 14,595,730 (GRCm39) nonsense probably null
R8811:Smoc2 UTSW 17 14,545,896 (GRCm39) missense probably damaging 1.00
R9287:Smoc2 UTSW 17 14,619,686 (GRCm39) missense probably damaging 1.00
X0026:Smoc2 UTSW 17 14,556,895 (GRCm39) missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TCTGCTCTTGTGGGAACAGAG -3'
(R):5'- AATACTGTGAGACTTCTGAGGGTG -3'

Sequencing Primer
(F):5'- AGGGAGGCACCTGCTATG -3'
(R):5'- CAAGATGACTGTTTCCCACTCAATG -3'
Posted On 2022-02-07