Incidental Mutation 'R9215:Wisp2'
ID 699108
Institutional Source Beutler Lab
Gene Symbol Wisp2
Ensembl Gene ENSMUSG00000027656
Gene Name WNT1 inducible signaling pathway protein 2
Synonyms rCop1, Crgr4, CCN5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9215 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 163820861-163833146 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 163829046 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 158 (C158S)
Ref Sequence ENSEMBL: ENSMUSP00000029188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029188]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029188
AA Change: C158S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029188
Gene: ENSMUSG00000027656
AA Change: C158S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IB 24 93 1.67e-16 SMART
VWC 100 163 5.9e-16 SMART
TSP1 195 239 9.68e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viabe and overtly normal with no adult bone phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo3 G A 9: 108,054,439 A354T probably damaging Het
Ano1 A G 7: 144,595,605 S840P probably damaging Het
Arap1 A G 7: 101,400,007 Q923R probably benign Het
Blk T C 14: 63,373,550 M448V probably damaging Het
Calhm2 C A 19: 47,132,866 R288L possibly damaging Het
Card11 A T 5: 140,880,399 M913K possibly damaging Het
Carf A C 1: 60,150,645 E676D possibly damaging Het
Ccr2 A G 9: 124,105,986 D101G probably damaging Het
Ckap2l T C 2: 129,281,906 R532G possibly damaging Het
Clec1a T C 6: 129,435,171 T112A possibly damaging Het
Clint1 T C 11: 45,883,751 V28A probably damaging Het
Col13a1 C A 10: 61,850,211 probably null Het
Cryz G T 3: 154,618,809 V216F probably benign Het
Cyp1a1 G A 9: 57,702,173 V386I probably benign Het
Cyp2c54 G A 19: 40,047,506 T320I possibly damaging Het
Dock7 G C 4: 98,970,851 N1431K unknown Het
Fam110c G T 12: 31,073,864 probably benign Het
Fam160a2 A G 7: 105,385,089 L445P possibly damaging Het
Fbn2 A T 18: 58,076,675 C1045S probably damaging Het
Fbxo30 G A 10: 11,291,499 R655H probably damaging Het
Gbp2 T C 3: 142,632,275 probably null Het
Gm5861 A T 5: 11,186,482 I161F possibly damaging Het
Hmgcll1 A G 9: 76,074,801 D176G probably benign Het
Inafm1 A T 7: 16,273,130 I54N probably damaging Het
Ipo9 C G 1: 135,419,295 M152I probably benign Het
Khdrbs3 C T 15: 69,092,949 T333M probably damaging Het
Lefty2 A G 1: 180,897,580 T292A probably benign Het
Lgr5 T C 10: 115,475,180 E237G probably damaging Het
Lrig2 T A 3: 104,491,008 E268D probably benign Het
Mbtd1 T A 11: 93,943,802 L602Q possibly damaging Het
Mtbp T C 15: 55,620,639 V828A possibly damaging Het
Ncapd3 C A 9: 27,064,090 Q812K possibly damaging Het
Nlrx1 T C 9: 44,254,028 K857R probably benign Het
Olfr1367 C T 13: 21,347,834 A302V probably damaging Het
Olfr1428 A T 19: 12,108,652 M72K probably damaging Het
Olfr728 T C 14: 50,140,372 Y89C probably benign Het
Olfr905 C T 9: 38,473,398 S217F probably damaging Het
P4ha2 T C 11: 54,126,400 F456L probably benign Het
Palm2 T A 4: 57,709,595 V180E probably damaging Het
Pard3b A G 1: 62,164,185 D424G probably damaging Het
Pecam1 A G 11: 106,688,971 S422P probably damaging Het
Pias2 T A 18: 77,128,981 V296E probably damaging Het
Plekha5 T A 6: 140,556,007 S640R possibly damaging Het
Prdx2 A G 8: 84,971,303 K92E possibly damaging Het
Prl7c1 C T 13: 27,776,221 E113K probably benign Het
Pxylp1 A T 9: 96,825,058 V357D possibly damaging Het
Rbm12b2 T C 4: 12,095,471 F777L probably damaging Het
Rbm4b G T 19: 4,762,240 V226F possibly damaging Het
Rel T C 11: 23,748,870 D139G probably benign Het
Rnf214 C T 9: 45,904,831 D28N probably benign Het
Slc26a5 A G 5: 21,837,287 S224P possibly damaging Het
Slc39a6 C T 18: 24,599,266 A322T probably benign Het
Slc47a1 T C 11: 61,371,821 I81V probably benign Het
Smad5 T A 13: 56,733,002 C310S probably damaging Het
Sparcl1 T C 5: 104,092,835 D241G probably benign Het
Spata16 C T 3: 26,667,845 Q172* probably null Het
Spata31d1d G T 13: 59,728,009 Q571K probably benign Het
Sspo G A 6: 48,463,935 R1777H possibly damaging Het
Stt3b A T 9: 115,256,155 F381I probably damaging Het
Tjp1 T C 7: 65,312,847 Y1194C probably benign Het
Tmem132b T C 5: 125,787,116 I762T probably damaging Het
Tnxb A G 17: 34,672,590 T636A unknown Het
Trat1 T A 16: 48,754,274 R54* probably null Het
Tubb4a A T 17: 57,080,769 V419E probably damaging Het
Txn2 A T 15: 77,919,765 W84R unknown Het
Uggt2 A G 14: 119,041,594 Y834H probably damaging Het
Upp2 T C 2: 58,780,053 L257P probably damaging Het
Vmn2r67 C T 7: 85,152,800 V98I probably benign Het
Zfp354c T C 11: 50,815,839 I136M probably benign Het
Other mutations in Wisp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Wisp2 APN 2 163829022 missense probably damaging 1.00
BB002:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
BB012:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
R0336:Wisp2 UTSW 2 163832322 missense probably damaging 0.98
R0600:Wisp2 UTSW 2 163825313 missense probably damaging 1.00
R1241:Wisp2 UTSW 2 163829077 missense unknown
R1779:Wisp2 UTSW 2 163828986 missense probably damaging 1.00
R2921:Wisp2 UTSW 2 163832346 missense probably benign 0.11
R2923:Wisp2 UTSW 2 163832346 missense probably benign 0.11
R4049:Wisp2 UTSW 2 163828984 missense probably damaging 1.00
R4344:Wisp2 UTSW 2 163828986 missense probably damaging 1.00
R5409:Wisp2 UTSW 2 163825238 missense probably damaging 1.00
R5529:Wisp2 UTSW 2 163825359 critical splice donor site probably null
R5663:Wisp2 UTSW 2 163825253 missense probably damaging 1.00
R6401:Wisp2 UTSW 2 163829026 missense probably benign 0.45
R6685:Wisp2 UTSW 2 163828948 missense possibly damaging 0.87
R7242:Wisp2 UTSW 2 163828852 missense probably benign 0.27
R7925:Wisp2 UTSW 2 163829041 missense possibly damaging 0.82
R8066:Wisp2 UTSW 2 163828942 missense probably damaging 1.00
R8701:Wisp2 UTSW 2 163828866 missense probably damaging 1.00
R8962:Wisp2 UTSW 2 163825240 nonsense probably null
R9656:Wisp2 UTSW 2 163829065 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGTGCAGTCGAAGAGGATGAC -3'
(R):5'- CACCTGAACTTGAACTATGTCTTAC -3'

Sequencing Primer
(F):5'- CGGGAGCTGTGAGGTGAATG -3'
(R):5'- ATACCATGTGCATGCCTGG -3'
Posted On 2022-02-07