Incidental Mutation 'R9215:Ccn5'
ID 699108
Institutional Source Beutler Lab
Gene Symbol Ccn5
Ensembl Gene ENSMUSG00000027656
Gene Name cellular communication network factor 5
Synonyms CCN5, Wisp2, Crgr4, rCop1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9215 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 163662781-163675066 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 163670966 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 158 (C158S)
Ref Sequence ENSEMBL: ENSMUSP00000029188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029188]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029188
AA Change: C158S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029188
Gene: ENSMUSG00000027656
AA Change: C158S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IB 24 93 1.67e-16 SMART
VWC 100 163 5.9e-16 SMART
TSP1 195 239 9.68e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viabe and overtly normal with no adult bone phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo3 G A 9: 107,931,638 (GRCm39) A354T probably damaging Het
Ano1 A G 7: 144,149,342 (GRCm39) S840P probably damaging Het
Arap1 A G 7: 101,049,214 (GRCm39) Q923R probably benign Het
Blk T C 14: 63,610,999 (GRCm39) M448V probably damaging Het
Calhm2 C A 19: 47,121,305 (GRCm39) R288L possibly damaging Het
Card11 A T 5: 140,866,154 (GRCm39) M913K possibly damaging Het
Carf A C 1: 60,189,804 (GRCm39) E676D possibly damaging Het
Ccr2 A G 9: 123,906,023 (GRCm39) D101G probably damaging Het
Ckap2l T C 2: 129,123,826 (GRCm39) R532G possibly damaging Het
Clec1a T C 6: 129,412,134 (GRCm39) T112A possibly damaging Het
Clint1 T C 11: 45,774,578 (GRCm39) V28A probably damaging Het
Col13a1 C A 10: 61,685,990 (GRCm39) probably null Het
Cryz G T 3: 154,324,446 (GRCm39) V216F probably benign Het
Cyp1a1 G A 9: 57,609,456 (GRCm39) V386I probably benign Het
Cyp2c54 G A 19: 40,035,950 (GRCm39) T320I possibly damaging Het
Dock7 G C 4: 98,859,088 (GRCm39) N1431K unknown Het
Fam110c G T 12: 31,123,863 (GRCm39) probably benign Het
Fbn2 A T 18: 58,209,747 (GRCm39) C1045S probably damaging Het
Fbxo30 G A 10: 11,167,243 (GRCm39) R655H probably damaging Het
Fhip1b A G 7: 105,034,296 (GRCm39) L445P possibly damaging Het
Gbp2 T C 3: 142,338,036 (GRCm39) probably null Het
Hmgcll1 A G 9: 75,982,083 (GRCm39) D176G probably benign Het
Inafm1 A T 7: 16,007,055 (GRCm39) I54N probably damaging Het
Ipo9 C G 1: 135,347,033 (GRCm39) M152I probably benign Het
Khdrbs3 C T 15: 68,964,798 (GRCm39) T333M probably damaging Het
Lefty2 A G 1: 180,725,145 (GRCm39) T292A probably benign Het
Lgr5 T C 10: 115,311,085 (GRCm39) E237G probably damaging Het
Lrig2 T A 3: 104,398,324 (GRCm39) E268D probably benign Het
Mbtd1 T A 11: 93,834,628 (GRCm39) L602Q possibly damaging Het
Mtbp T C 15: 55,484,035 (GRCm39) V828A possibly damaging Het
Ncapd3 C A 9: 26,975,386 (GRCm39) Q812K possibly damaging Het
Nlrx1 T C 9: 44,165,325 (GRCm39) K857R probably benign Het
Or2b28 C T 13: 21,532,004 (GRCm39) A302V probably damaging Het
Or4d6 A T 19: 12,086,016 (GRCm39) M72K probably damaging Het
Or4k1 T C 14: 50,377,829 (GRCm39) Y89C probably benign Het
Or8b1c C T 9: 38,384,694 (GRCm39) S217F probably damaging Het
P4ha2 T C 11: 54,017,226 (GRCm39) F456L probably benign Het
Pakap T A 4: 57,709,595 (GRCm39) V180E probably damaging Het
Pard3b A G 1: 62,203,344 (GRCm39) D424G probably damaging Het
Pecam1 A G 11: 106,579,797 (GRCm39) S422P probably damaging Het
Pias2 T A 18: 77,216,677 (GRCm39) V296E probably damaging Het
Plekha5 T A 6: 140,501,733 (GRCm39) S640R possibly damaging Het
Prdx2 A G 8: 85,697,932 (GRCm39) K92E possibly damaging Het
Prl7c1 C T 13: 27,960,204 (GRCm39) E113K probably benign Het
Pxylp1 A T 9: 96,707,111 (GRCm39) V357D possibly damaging Het
Rbm12b2 T C 4: 12,095,471 (GRCm39) F777L probably damaging Het
Rbm4b G T 19: 4,812,268 (GRCm39) V226F possibly damaging Het
Rel T C 11: 23,698,870 (GRCm39) D139G probably benign Het
Rnf214 C T 9: 45,816,129 (GRCm39) D28N probably benign Het
Slc26a5 A G 5: 22,042,285 (GRCm39) S224P possibly damaging Het
Slc39a6 C T 18: 24,732,323 (GRCm39) A322T probably benign Het
Slc47a1 T C 11: 61,262,647 (GRCm39) I81V probably benign Het
Smad5 T A 13: 56,880,815 (GRCm39) C310S probably damaging Het
Sparcl1 T C 5: 104,240,701 (GRCm39) D241G probably benign Het
Spata16 C T 3: 26,721,994 (GRCm39) Q172* probably null Het
Spata31d1d G T 13: 59,875,823 (GRCm39) Q571K probably benign Het
Speer1e A T 5: 11,236,449 (GRCm39) I161F possibly damaging Het
Sspo G A 6: 48,440,869 (GRCm39) R1777H possibly damaging Het
Stt3b A T 9: 115,085,223 (GRCm39) F381I probably damaging Het
Tjp1 T C 7: 64,962,595 (GRCm39) Y1194C probably benign Het
Tmem132b T C 5: 125,864,180 (GRCm39) I762T probably damaging Het
Tnxb A G 17: 34,891,564 (GRCm39) T636A unknown Het
Trat1 T A 16: 48,574,637 (GRCm39) R54* probably null Het
Tubb4a A T 17: 57,387,769 (GRCm39) V419E probably damaging Het
Txn2 A T 15: 77,803,965 (GRCm39) W84R unknown Het
Uggt2 A G 14: 119,279,006 (GRCm39) Y834H probably damaging Het
Upp2 T C 2: 58,670,065 (GRCm39) L257P probably damaging Het
Vmn2r67 C T 7: 84,802,008 (GRCm39) V98I probably benign Het
Zfp354c T C 11: 50,706,666 (GRCm39) I136M probably benign Het
Other mutations in Ccn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Ccn5 APN 2 163,670,942 (GRCm39) missense probably damaging 1.00
BB002:Ccn5 UTSW 2 163,670,961 (GRCm39) missense possibly damaging 0.82
BB012:Ccn5 UTSW 2 163,670,961 (GRCm39) missense possibly damaging 0.82
R0336:Ccn5 UTSW 2 163,674,242 (GRCm39) missense probably damaging 0.98
R0600:Ccn5 UTSW 2 163,667,233 (GRCm39) missense probably damaging 1.00
R1241:Ccn5 UTSW 2 163,670,997 (GRCm39) missense unknown
R1779:Ccn5 UTSW 2 163,670,906 (GRCm39) missense probably damaging 1.00
R2921:Ccn5 UTSW 2 163,674,266 (GRCm39) missense probably benign 0.11
R2923:Ccn5 UTSW 2 163,674,266 (GRCm39) missense probably benign 0.11
R4049:Ccn5 UTSW 2 163,670,904 (GRCm39) missense probably damaging 1.00
R4344:Ccn5 UTSW 2 163,670,906 (GRCm39) missense probably damaging 1.00
R5409:Ccn5 UTSW 2 163,667,158 (GRCm39) missense probably damaging 1.00
R5529:Ccn5 UTSW 2 163,667,279 (GRCm39) critical splice donor site probably null
R5663:Ccn5 UTSW 2 163,667,173 (GRCm39) missense probably damaging 1.00
R6401:Ccn5 UTSW 2 163,670,946 (GRCm39) missense probably benign 0.45
R6685:Ccn5 UTSW 2 163,670,868 (GRCm39) missense possibly damaging 0.87
R7242:Ccn5 UTSW 2 163,670,772 (GRCm39) missense probably benign 0.27
R7925:Ccn5 UTSW 2 163,670,961 (GRCm39) missense possibly damaging 0.82
R8066:Ccn5 UTSW 2 163,670,862 (GRCm39) missense probably damaging 1.00
R8701:Ccn5 UTSW 2 163,670,786 (GRCm39) missense probably damaging 1.00
R8962:Ccn5 UTSW 2 163,667,160 (GRCm39) nonsense probably null
R9656:Ccn5 UTSW 2 163,670,985 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGTGCAGTCGAAGAGGATGAC -3'
(R):5'- CACCTGAACTTGAACTATGTCTTAC -3'

Sequencing Primer
(F):5'- CGGGAGCTGTGAGGTGAATG -3'
(R):5'- ATACCATGTGCATGCCTGG -3'
Posted On 2022-02-07