Incidental Mutation 'R9216:Ntn1'
ID 699204
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Name netrin 1
Synonyms Netrin-1
MMRRC Submission 068958-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.735) question?
Stock # R9216 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 68100190-68277652 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 68117397 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 484 (K484R)
Ref Sequence ENSEMBL: ENSMUSP00000021284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674]
AlphaFold O09118
PDB Structure X-ray Crystal Structure of Mouse Netrin-1 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021284
AA Change: K484R

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: K484R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108674
AA Change: K484R

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: K484R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap6 A T 12: 52,927,668 (GRCm39) T193S probably benign Het
Anpep T C 7: 79,486,049 (GRCm39) T558A possibly damaging Het
Asap2 A G 12: 21,263,191 (GRCm39) I269V probably benign Het
B3galnt2 T C 13: 14,165,423 (GRCm39) V273A probably benign Het
Bag3 C A 7: 128,143,923 (GRCm39) D306E possibly damaging Het
Bahcc1 C T 11: 120,177,514 (GRCm39) P2076S probably damaging Het
Btbd7 A C 12: 102,761,563 (GRCm39) L541V probably damaging Het
C6 A T 15: 4,820,465 (GRCm39) D492V probably damaging Het
Cdhr5 C T 7: 140,851,615 (GRCm39) S563N possibly damaging Het
Cnn1 C G 9: 22,019,474 (GRCm39) L281V probably benign Het
Egflam G A 15: 7,281,942 (GRCm39) T398I probably benign Het
Eif4g2 T G 7: 110,673,415 (GRCm39) D788A probably benign Het
Elavl4 T C 4: 110,108,546 (GRCm39) E66G probably damaging Het
Fbxw16 T A 9: 109,276,887 (GRCm39) D87V probably damaging Het
Fsip2 A T 2: 82,820,425 (GRCm39) D5386V probably damaging Het
Ftl1 A C 7: 45,108,959 (GRCm39) S33A probably benign Het
Gm21560 T C 14: 6,218,338 (GRCm38) R47G probably damaging Het
Itpkc A T 7: 26,927,429 (GRCm39) C162S probably benign Het
Katnip T A 7: 125,471,926 (GRCm39) I1531N probably damaging Het
Kremen2 C T 17: 23,962,781 (GRCm39) A102T probably damaging Het
L3mbtl1 A T 2: 162,806,972 (GRCm39) Q480L probably benign Het
Lyst T C 13: 13,823,188 (GRCm39) C1387R probably benign Het
Nmi A G 2: 51,846,003 (GRCm39) V93A probably damaging Het
Olig1 T C 16: 91,066,915 (GRCm39) S51P probably benign Het
Or6c76 A T 10: 129,611,796 (GRCm39) R4S probably benign Het
Pah G T 10: 87,357,888 (GRCm39) V4F probably benign Het
Peg10 GC GCTCC 6: 4,756,452 (GRCm39) probably benign Het
Pramel39-ps A T 5: 94,450,952 (GRCm39) N391K possibly damaging Het
Prox1 C A 1: 189,892,905 (GRCm39) E513D possibly damaging Het
Psd3 T C 8: 68,573,539 (GRCm39) N214S probably benign Het
Rhobtb1 A G 10: 69,108,628 (GRCm39) S505G probably benign Het
Ryr1 A T 7: 28,801,277 (GRCm39) L829H probably damaging Het
Sec16a A T 2: 26,304,401 (GRCm39) D852E Het
Senp2 T C 16: 21,847,344 (GRCm39) probably null Het
Sf3b1 A G 1: 55,051,376 (GRCm39) V184A probably benign Het
Skint5 T C 4: 113,392,955 (GRCm39) T1226A unknown Het
Slc1a6 G A 10: 78,637,692 (GRCm39) R406H probably damaging Het
Slc26a4 C A 12: 31,578,659 (GRCm39) V665L possibly damaging Het
Spef2 T C 15: 9,647,611 (GRCm39) Y932C probably damaging Het
Spidr T A 16: 15,936,814 (GRCm39) N97I probably benign Het
Ttn A G 2: 76,748,504 (GRCm39) S4182P probably damaging Het
Tubb6 T C 18: 67,534,514 (GRCm39) S138P probably damaging Het
Ubr2 C T 17: 47,292,285 (GRCm39) A393T probably benign Het
Utrn G T 10: 12,689,229 (GRCm39) P19T probably benign Het
Vcl T G 14: 21,033,515 (GRCm39) L157W probably damaging Het
Vmn1r184 A T 7: 25,966,703 (GRCm39) I150F probably benign Het
Vmn1r22 A T 6: 57,877,257 (GRCm39) M240K possibly damaging Het
Vmn2r14 A T 5: 109,369,112 (GRCm39) S154T probably benign Het
Wbp2 T C 11: 115,974,724 (GRCm39) N37D probably benign Het
Zfc3h1 C G 10: 115,221,528 (GRCm39) D142E unknown Het
Zmym6 T C 4: 127,002,500 (GRCm39) V577A probably benign Het
Zxdc C A 6: 90,359,189 (GRCm39) T607K probably benign Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68,117,445 (GRCm39) splice site probably benign
IGL00972:Ntn1 APN 11 68,104,098 (GRCm39) missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68,117,430 (GRCm39) missense probably benign 0.00
IGL01731:Ntn1 APN 11 68,276,244 (GRCm39) missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68,104,089 (GRCm39) missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68,168,356 (GRCm39) missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68,276,295 (GRCm39) missense probably benign 0.06
R0363:Ntn1 UTSW 11 68,276,369 (GRCm39) missense probably benign 0.44
R1201:Ntn1 UTSW 11 68,104,052 (GRCm39) missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68,103,959 (GRCm39) small deletion probably benign
R1913:Ntn1 UTSW 11 68,104,011 (GRCm39) missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68,276,120 (GRCm39) missense probably benign 0.12
R2248:Ntn1 UTSW 11 68,168,398 (GRCm39) missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68,276,438 (GRCm39) missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68,276,690 (GRCm39) missense probably benign 0.00
R3830:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68,276,736 (GRCm39) missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R4871:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R4952:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R5001:Ntn1 UTSW 11 68,151,358 (GRCm39) missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68,276,538 (GRCm39) missense probably benign 0.37
R6217:Ntn1 UTSW 11 68,104,158 (GRCm39) missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68,104,025 (GRCm39) missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68,276,576 (GRCm39) missense probably benign 0.00
R7172:Ntn1 UTSW 11 68,276,493 (GRCm39) missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68,276,915 (GRCm39) missense probably benign 0.15
R8314:Ntn1 UTSW 11 68,276,450 (GRCm39) missense probably damaging 1.00
R9385:Ntn1 UTSW 11 68,276,013 (GRCm39) missense probably damaging 1.00
R9442:Ntn1 UTSW 11 68,148,485 (GRCm39) intron probably benign
R9697:Ntn1 UTSW 11 68,168,356 (GRCm39) missense probably damaging 1.00
R9752:Ntn1 UTSW 11 68,276,712 (GRCm39) missense possibly damaging 0.80
X0027:Ntn1 UTSW 11 68,276,462 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAGGAATCTCAGCCTCGATGG -3'
(R):5'- CTTTAGAAAGCCAGCCTGCC -3'

Sequencing Primer
(F):5'- TGATCCAGATGCCCCTGTG -3'
(R):5'- AGCCAGCCTGCCCTGAATG -3'
Posted On 2022-02-07