Incidental Mutation 'R9216:Ntn1'
ID 699204
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Name netrin 1
Synonyms Netrin-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock # R9216 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 68209364-68400823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 68226571 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 484 (K484R)
Ref Sequence ENSEMBL: ENSMUSP00000021284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674]
AlphaFold O09118
PDB Structure X-ray Crystal Structure of Mouse Netrin-1 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021284
AA Change: K484R

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: K484R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108674
AA Change: K484R

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: K484R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430089I19Rik A T 5: 94,303,093 N391K possibly damaging Het
Akap6 A T 12: 52,880,885 T193S probably benign Het
Anpep T C 7: 79,836,301 T558A possibly damaging Het
Asap2 A G 12: 21,213,190 I269V probably benign Het
B3galnt2 T C 13: 13,990,838 V273A probably benign Het
Bag3 C A 7: 128,542,199 D306E possibly damaging Het
Bahcc1 C T 11: 120,286,688 P2076S probably damaging Het
Btbd7 A C 12: 102,795,304 L541V probably damaging Het
C6 A T 15: 4,790,983 D492V probably damaging Het
Cdhr5 C T 7: 141,271,702 S563N possibly damaging Het
Cnn1 C G 9: 22,108,178 L281V probably benign Het
D430042O09Rik T A 7: 125,872,754 I1531N probably damaging Het
Egflam G A 15: 7,252,461 T398I probably benign Het
Eif4g2 T G 7: 111,074,208 D788A probably benign Het
Elavl4 T C 4: 110,251,349 E66G probably damaging Het
Fbxw16 T A 9: 109,447,819 D87V probably damaging Het
Fsip2 A T 2: 82,990,081 D5386V probably damaging Het
Ftl1 A C 7: 45,459,535 S33A probably benign Het
Gm21560 T C 14: 6,218,338 R47G probably damaging Het
Itpkc A T 7: 27,228,004 C162S probably benign Het
Kremen2 C T 17: 23,743,807 A102T probably damaging Het
L3mbtl1 A T 2: 162,965,052 Q480L probably benign Het
Lyst T C 13: 13,648,603 C1387R probably benign Het
Nmi A G 2: 51,955,991 V93A probably damaging Het
Olfr809 A T 10: 129,775,927 R4S probably benign Het
Olig1 T C 16: 91,270,027 S51P probably benign Het
Pah G T 10: 87,522,026 V4F probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Prox1 C A 1: 190,160,708 E513D possibly damaging Het
Psd3 T C 8: 68,120,887 N214S probably benign Het
Rhobtb1 A G 10: 69,272,798 S505G probably benign Het
Ryr1 A T 7: 29,101,852 L829H probably damaging Het
Sec16a A T 2: 26,414,389 D852E Het
Senp2 T C 16: 22,028,594 probably null Het
Sf3b1 A G 1: 55,012,217 V184A probably benign Het
Skint5 T C 4: 113,535,758 T1226A unknown Het
Slc1a6 G A 10: 78,801,858 R406H probably damaging Het
Slc26a4 C A 12: 31,528,660 V665L possibly damaging Het
Spef2 T C 15: 9,647,525 Y932C probably damaging Het
Spidr T A 16: 16,118,950 N97I probably benign Het
Ttn A G 2: 76,918,160 S4182P probably damaging Het
Tubb6 T C 18: 67,401,444 S138P probably damaging Het
Ubr2 C T 17: 46,981,359 A393T probably benign Het
Utrn G T 10: 12,813,485 P19T probably benign Het
Vcl T G 14: 20,983,447 L157W probably damaging Het
Vmn1r184 A T 7: 26,267,278 I150F probably benign Het
Vmn1r22 A T 6: 57,900,272 M240K possibly damaging Het
Vmn2r14 A T 5: 109,221,246 S154T probably benign Het
Wbp2 T C 11: 116,083,898 N37D probably benign Het
Zfc3h1 C G 10: 115,385,623 D142E unknown Het
Zmym6 T C 4: 127,108,707 V577A probably benign Het
Zxdc C A 6: 90,382,207 T607K probably benign Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68226619 splice site probably benign
IGL00972:Ntn1 APN 11 68213272 missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68226604 missense probably benign 0.00
IGL01731:Ntn1 APN 11 68385418 missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68213263 missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68277530 missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68385469 missense probably benign 0.06
R0363:Ntn1 UTSW 11 68385543 missense probably benign 0.44
R1201:Ntn1 UTSW 11 68213226 missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68213133 small deletion probably benign
R1913:Ntn1 UTSW 11 68213185 missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68385294 missense probably benign 0.12
R2248:Ntn1 UTSW 11 68277572 missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68385612 missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68385864 missense probably benign 0.00
R3830:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68385910 missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68213026 small deletion probably benign
R4871:Ntn1 UTSW 11 68213026 small deletion probably benign
R4952:Ntn1 UTSW 11 68213026 small deletion probably benign
R5001:Ntn1 UTSW 11 68260532 missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68385712 missense probably benign 0.37
R6217:Ntn1 UTSW 11 68213332 missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68213199 missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68385750 missense probably benign 0.00
R7172:Ntn1 UTSW 11 68385667 missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68386089 missense probably benign 0.15
R8314:Ntn1 UTSW 11 68385624 missense probably damaging 1.00
R9385:Ntn1 UTSW 11 68385187 missense probably damaging 1.00
R9442:Ntn1 UTSW 11 68257659 intron probably benign
R9697:Ntn1 UTSW 11 68277530 missense probably damaging 1.00
R9752:Ntn1 UTSW 11 68385886 missense possibly damaging 0.80
X0027:Ntn1 UTSW 11 68385636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAGGAATCTCAGCCTCGATGG -3'
(R):5'- CTTTAGAAAGCCAGCCTGCC -3'

Sequencing Primer
(F):5'- TGATCCAGATGCCCCTGTG -3'
(R):5'- AGCCAGCCTGCCCTGAATG -3'
Posted On 2022-02-07