Incidental Mutation 'R9216:Btbd7'
ID 699210
Institutional Source Beutler Lab
Gene Symbol Btbd7
Ensembl Gene ENSMUSG00000041702
Gene Name BTB (POZ) domain containing 7
Synonyms FUP1, E130118E17Rik, 5730507E09Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.429) question?
Stock # R9216 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 102780797-102878471 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 102795304 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 541 (L541V)
Ref Sequence ENSEMBL: ENSMUSP00000046951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045652] [ENSMUST00000223554]
AlphaFold Q8CFE5
Predicted Effect probably damaging
Transcript: ENSMUST00000045652
AA Change: L541V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046951
Gene: ENSMUSG00000041702
AA Change: L541V

DomainStartEndE-ValueType
BTB 142 244 1.57e-13 SMART
BTB 247 397 2.23e-4 SMART
BACK 402 538 1.49e-4 SMART
low complexity region 626 640 N/A INTRINSIC
low complexity region 756 771 N/A INTRINSIC
low complexity region 783 792 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 839 850 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223554
AA Change: L541V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430089I19Rik A T 5: 94,303,093 N391K possibly damaging Het
Akap6 A T 12: 52,880,885 T193S probably benign Het
Anpep T C 7: 79,836,301 T558A possibly damaging Het
Asap2 A G 12: 21,213,190 I269V probably benign Het
B3galnt2 T C 13: 13,990,838 V273A probably benign Het
Bag3 C A 7: 128,542,199 D306E possibly damaging Het
Bahcc1 C T 11: 120,286,688 P2076S probably damaging Het
C6 A T 15: 4,790,983 D492V probably damaging Het
Cdhr5 C T 7: 141,271,702 S563N possibly damaging Het
Cnn1 C G 9: 22,108,178 L281V probably benign Het
D430042O09Rik T A 7: 125,872,754 I1531N probably damaging Het
Egflam G A 15: 7,252,461 T398I probably benign Het
Eif4g2 T G 7: 111,074,208 D788A probably benign Het
Elavl4 T C 4: 110,251,349 E66G probably damaging Het
Fbxw16 T A 9: 109,447,819 D87V probably damaging Het
Fsip2 A T 2: 82,990,081 D5386V probably damaging Het
Ftl1 A C 7: 45,459,535 S33A probably benign Het
Gm21560 T C 14: 6,218,338 R47G probably damaging Het
Itpkc A T 7: 27,228,004 C162S probably benign Het
Kremen2 C T 17: 23,743,807 A102T probably damaging Het
L3mbtl1 A T 2: 162,965,052 Q480L probably benign Het
Lyst T C 13: 13,648,603 C1387R probably benign Het
Nmi A G 2: 51,955,991 V93A probably damaging Het
Ntn1 T C 11: 68,226,571 K484R possibly damaging Het
Olfr809 A T 10: 129,775,927 R4S probably benign Het
Olig1 T C 16: 91,270,027 S51P probably benign Het
Pah G T 10: 87,522,026 V4F probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Prox1 C A 1: 190,160,708 E513D possibly damaging Het
Psd3 T C 8: 68,120,887 N214S probably benign Het
Rhobtb1 A G 10: 69,272,798 S505G probably benign Het
Ryr1 A T 7: 29,101,852 L829H probably damaging Het
Sec16a A T 2: 26,414,389 D852E Het
Senp2 T C 16: 22,028,594 probably null Het
Sf3b1 A G 1: 55,012,217 V184A probably benign Het
Skint5 T C 4: 113,535,758 T1226A unknown Het
Slc1a6 G A 10: 78,801,858 R406H probably damaging Het
Slc26a4 C A 12: 31,528,660 V665L possibly damaging Het
Spef2 T C 15: 9,647,525 Y932C probably damaging Het
Spidr T A 16: 16,118,950 N97I probably benign Het
Ttn A G 2: 76,918,160 S4182P probably damaging Het
Tubb6 T C 18: 67,401,444 S138P probably damaging Het
Ubr2 C T 17: 46,981,359 A393T probably benign Het
Utrn G T 10: 12,813,485 P19T probably benign Het
Vcl T G 14: 20,983,447 L157W probably damaging Het
Vmn1r184 A T 7: 26,267,278 I150F probably benign Het
Vmn1r22 A T 6: 57,900,272 M240K possibly damaging Het
Vmn2r14 A T 5: 109,221,246 S154T probably benign Het
Wbp2 T C 11: 116,083,898 N37D probably benign Het
Zfc3h1 C G 10: 115,385,623 D142E unknown Het
Zmym6 T C 4: 127,108,707 V577A probably benign Het
Zxdc C A 6: 90,382,207 T607K probably benign Het
Other mutations in Btbd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02047:Btbd7 APN 12 102793779 missense probably benign 0.10
IGL02899:Btbd7 APN 12 102837662 missense probably damaging 1.00
IGL03204:Btbd7 APN 12 102807980 nonsense probably null
H8562:Btbd7 UTSW 12 102788302 missense probably benign 0.26
IGL03050:Btbd7 UTSW 12 102812806 missense probably benign 0.03
R1262:Btbd7 UTSW 12 102787951 missense probably benign
R1423:Btbd7 UTSW 12 102785475 missense possibly damaging 0.49
R1437:Btbd7 UTSW 12 102788090 missense possibly damaging 0.59
R1636:Btbd7 UTSW 12 102793851 missense probably damaging 1.00
R1641:Btbd7 UTSW 12 102790775 missense probably damaging 1.00
R1722:Btbd7 UTSW 12 102812654 missense possibly damaging 0.96
R1921:Btbd7 UTSW 12 102793796 missense probably benign 0.01
R2021:Btbd7 UTSW 12 102790709 missense probably damaging 1.00
R2180:Btbd7 UTSW 12 102785897 missense probably damaging 1.00
R3768:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3770:Btbd7 UTSW 12 102795192 missense probably damaging 1.00
R3786:Btbd7 UTSW 12 102838152 missense probably benign 0.22
R4396:Btbd7 UTSW 12 102785293 missense probably benign 0.00
R4809:Btbd7 UTSW 12 102793744 critical splice donor site probably null
R4910:Btbd7 UTSW 12 102808048 missense probably damaging 0.98
R4915:Btbd7 UTSW 12 102837787 nonsense probably null
R5054:Btbd7 UTSW 12 102838212 missense probably benign 0.02
R5276:Btbd7 UTSW 12 102838392 missense probably benign 0.00
R5387:Btbd7 UTSW 12 102837785 missense probably damaging 0.99
R5665:Btbd7 UTSW 12 102785197 missense probably benign
R7083:Btbd7 UTSW 12 102788335 missense probably damaging 0.99
R7354:Btbd7 UTSW 12 102838205 missense probably benign 0.05
R7429:Btbd7 UTSW 12 102837780 missense probably damaging 1.00
R7462:Btbd7 UTSW 12 102837722 missense possibly damaging 0.88
R7469:Btbd7 UTSW 12 102812768 missense probably damaging 0.99
R7998:Btbd7 UTSW 12 102795240 missense probably damaging 1.00
R8499:Btbd7 UTSW 12 102788372 missense probably damaging 1.00
R8773:Btbd7 UTSW 12 102837982 missense probably benign 0.02
R8783:Btbd7 UTSW 12 102788242 missense probably benign 0.45
R8968:Btbd7 UTSW 12 102812766 missense probably damaging 1.00
R9016:Btbd7 UTSW 12 102785158 missense probably damaging 1.00
R9027:Btbd7 UTSW 12 102838579 missense probably damaging 1.00
R9221:Btbd7 UTSW 12 102811171 missense probably damaging 1.00
R9471:Btbd7 UTSW 12 102793886 missense probably damaging 1.00
X0024:Btbd7 UTSW 12 102812686 nonsense probably null
X0025:Btbd7 UTSW 12 102811164 missense probably benign 0.06
Z1177:Btbd7 UTSW 12 102811120 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAAATCTCTGTGCGTATGGTTG -3'
(R):5'- ATGGTGCATATTGTTCACTGC -3'

Sequencing Primer
(F):5'- GGTTGGTAATAAAGTCATCTGCTACC -3'
(R):5'- GTGCATATTGTTCACTGCTACTGGAC -3'
Posted On 2022-02-07