Incidental Mutation 'R9218:Pms2'
ID 699307
Institutional Source Beutler Lab
Gene Symbol Pms2
Ensembl Gene ENSMUSG00000079109
Gene Name PMS1 homolog2, mismatch repair system component
Synonyms mismatch repair, DNA mismatch repair
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock # R9218 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 143909964-143933968 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 143931127 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 850 (V850I)
Ref Sequence ENSEMBL: ENSMUSP00000119875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110709] [ENSMUST00000148011] [ENSMUST00000166847]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000110709
AA Change: V452I
SMART Domains Protein: ENSMUSP00000106337
Gene: ENSMUSG00000079109
AA Change: V452I

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
MutL_C 277 421 1.59e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148011
AA Change: V850I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119875
Gene: ENSMUSG00000079109
AA Change: V850I

DomainStartEndE-ValueType
HATPase_c 30 165 3.77e-1 SMART
DNA_mis_repair 227 364 4.76e-41 SMART
MutL_C 675 819 1.59e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166847
SMART Domains Protein: ENSMUSP00000132687
Gene: ENSMUSG00000075569

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 39 50 N/A INTRINSIC
low complexity region 63 75 N/A INTRINSIC
MORN 107 128 5.9e-7 SMART
MORN 130 151 9.35e-1 SMART
MORN 153 174 1.23e0 SMART
MORN 177 198 1.84e0 SMART
MORN 202 223 3.21e1 SMART
MORN 225 246 1.67e-6 SMART
MORN 249 270 1.85e1 SMART
MORN 282 303 2.71e-6 SMART
MORN 305 326 3.53e-5 SMART
low complexity region 409 420 N/A INTRINSIC
low complexity region 629 649 N/A INTRINSIC
coiled coil region 787 841 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172367
SMART Domains Protein: ENSMUSP00000132104
Gene: ENSMUSG00000104633

DomainStartEndE-ValueType
MutL_C 5 139 1.78e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (57/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a key component of the mismatch repair system that functions to correct DNA mismatches and small insertions and deletions that can occur during DNA replication and homologous recombination. This protein forms heterodimers with the gene product of the mutL homolog 1 (MLH1) gene to form the MutL-alpha heterodimer. The MutL-alpha heterodimer possesses an endonucleolytic activity that is activated following recognition of mismatches and insertion/deletion loops by the MutS-alpha and MutS-beta heterodimers, and is necessary for removal of the mismatched DNA. There is a DQHA(X)2E(X)4E motif found at the C-terminus of the protein encoded by this gene that forms part of the active site of the nuclease. Mutations in this gene have been associated with hereditary nonpolyposis colorectal cancer (HNPCC; also known as Lynch syndrome) and Turcot syndrome. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit microsatellite instability and develop a high incidence of lymphomas with some sarcomas after 6 months of age. Mutant males are sterile, with impaired synapsis and only abnormal spermatozoa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,473,924 T378A probably damaging Het
5430419D17Rik C T 7: 131,261,999 H1244Y unknown Het
Abcb4 A G 5: 8,927,960 M513V probably benign Het
Abhd18 T C 3: 40,916,766 probably null Het
Adamtsl4 A T 3: 95,681,094 Y561* probably null Het
Alx4 T A 2: 93,642,827 F57I possibly damaging Het
Ap3b1 A G 13: 94,448,451 probably null Het
Arsj A C 3: 126,438,465 N287H probably benign Het
Cabp4 T A 19: 4,138,694 probably null Het
Cdh6 T C 15: 13,057,470 N255S probably null Het
Ctrb1 C T 8: 111,689,508 V49M probably damaging Het
Cts3 A G 13: 61,568,769 S18P possibly damaging Het
Dcst1 A T 3: 89,365,105 I17N probably benign Het
Dennd5a G A 7: 109,908,385 H823Y probably damaging Het
Dmrt2 T G 19: 25,673,702 L84R possibly damaging Het
Dock9 G T 14: 121,668,459 T93K probably damaging Het
Fsip2 C T 2: 82,992,718 P6265L probably damaging Het
Fxn T A 19: 24,262,024 K168M probably damaging Het
Hc A G 2: 35,032,191 L541P probably damaging Het
Hsd3b5 T C 3: 98,619,038 H364R probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Inf2 G A 12: 112,601,424 D163N possibly damaging Het
Iqcd C T 5: 120,600,642 P175L possibly damaging Het
Iqck C T 7: 118,941,679 A267V probably damaging Het
Kcnh1 A T 1: 192,453,630 N66I unknown Het
Kif16b T A 2: 142,699,663 E1239V possibly damaging Het
Mctp1 A G 13: 76,723,697 D362G possibly damaging Het
Muc5ac T A 7: 141,807,361 S1470T probably damaging Het
Neb A G 2: 52,293,626 probably null Het
Odc1 T A 12: 17,548,311 L151* probably null Het
Olfr1508 A T 14: 52,463,331 V226E probably damaging Het
Olfr562-ps1 T C 7: 102,782,166 I230T possibly damaging Het
Otof T A 5: 30,385,125 Q693L probably benign Het
Pitpnm2 G A 5: 124,127,281 S753F probably damaging Het
Pkd1l3 C A 8: 109,655,496 S1632* probably null Het
Pkhd1l1 A G 15: 44,520,726 T1171A possibly damaging Het
Plpp2 A G 10: 79,530,667 F104L probably damaging Het
Pmaip1 A G 18: 66,463,299 R80G probably damaging Het
Psmd5 G T 2: 34,857,782 Q288K probably benign Het
Rab37 G A 11: 115,160,649 R194H probably damaging Het
Sds C T 5: 120,483,612 A273V probably damaging Het
Sema4f A G 6: 82,913,499 S776P probably benign Het
Sh3tc2 T C 18: 61,968,030 C65R probably benign Het
Siglece C T 7: 43,657,738 R275H possibly damaging Het
Slc6a12 G A 6: 121,358,664 A318T probably damaging Het
Smcr8 A T 11: 60,779,879 I618L probably benign Het
Stt3a A G 9: 36,759,260 F72L probably damaging Het
Tecpr1 T C 5: 144,217,231 K135E possibly damaging Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Tnpo2 C A 8: 85,049,980 H439N possibly damaging Het
Txlnb C T 10: 17,842,822 S467F probably damaging Het
Tyw5 G A 1: 57,396,789 P81S probably damaging Het
Uhrf1bp1 T A 17: 27,895,555 C1387S probably benign Het
Vamp2 A G 11: 69,089,759 D51G possibly damaging Het
Vmn1r220 T A 13: 23,184,439 Y29F probably benign Het
Vmn2r80 A G 10: 79,194,436 T699A possibly damaging Het
Vps9d1 G A 8: 123,250,935 T87I probably benign Het
Zcchc11 A T 4: 108,512,886 K661* probably null Het
Zfhx3 T C 8: 108,793,869 V541A probably benign Het
Zmym4 A T 4: 126,915,622 L295Q probably damaging Het
Other mutations in Pms2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01893:Pms2 APN 5 143923519 missense probably damaging 1.00
IGL02009:Pms2 APN 5 143925764 missense probably benign 0.42
IGL02801:Pms2 APN 5 143925835 missense probably benign 0.06
P0047:Pms2 UTSW 5 143919598 missense probably damaging 1.00
R1367:Pms2 UTSW 5 143925913 missense probably damaging 1.00
R1422:Pms2 UTSW 5 143913705 missense probably damaging 1.00
R1854:Pms2 UTSW 5 143925896 missense probably benign 0.08
R1997:Pms2 UTSW 5 143913700 missense probably damaging 1.00
R2248:Pms2 UTSW 5 143916506 missense probably damaging 1.00
R2873:Pms2 UTSW 5 143911914 splice site probably benign
R4072:Pms2 UTSW 5 143929001 missense probably damaging 0.99
R4082:Pms2 UTSW 5 143931019 missense probably damaging 1.00
R4358:Pms2 UTSW 5 143925926 missense probably damaging 1.00
R5100:Pms2 UTSW 5 143928188 missense probably damaging 1.00
R5101:Pms2 UTSW 5 143928188 missense probably damaging 1.00
R5228:Pms2 UTSW 5 143923597 missense probably damaging 0.99
R5484:Pms2 UTSW 5 143928125 missense probably damaging 1.00
R6310:Pms2 UTSW 5 143923583 missense probably benign 0.06
R6331:Pms2 UTSW 5 143914633 missense possibly damaging 0.94
R6567:Pms2 UTSW 5 143928968 missense probably damaging 0.99
R6718:Pms2 UTSW 5 143923489 missense probably damaging 0.98
R6747:Pms2 UTSW 5 143925419 missense probably benign 0.02
R6980:Pms2 UTSW 5 143912024 missense probably benign 0.21
R7207:Pms2 UTSW 5 143913634 missense probably damaging 1.00
R7349:Pms2 UTSW 5 143925836 missense probably benign 0.11
R7657:Pms2 UTSW 5 143919539 missense possibly damaging 0.93
R7820:Pms2 UTSW 5 143914633 missense possibly damaging 0.80
R7980:Pms2 UTSW 5 143931091 missense probably damaging 1.00
R8213:Pms2 UTSW 5 143914771 missense probably damaging 1.00
R8534:Pms2 UTSW 5 143923627 missense probably benign 0.16
R9021:Pms2 UTSW 5 143925926 missense probably damaging 1.00
R9494:Pms2 UTSW 5 143916396 missense probably damaging 1.00
R9614:Pms2 UTSW 5 143917602 missense probably benign 0.01
R9712:Pms2 UTSW 5 143914796 missense probably damaging 0.99
X0064:Pms2 UTSW 5 143916466 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGAACCCCGTGCTTCCAAG -3'
(R):5'- CAGAACAGTAACTGCAGACATG -3'

Sequencing Primer
(F):5'- GTGCTTCCAAGGATGCTCTAAC -3'
(R):5'- GATCTCCCAAGTAGCTGAGCTAG -3'
Posted On 2022-02-07