Mutagenetix > Incidental Mutation

Incidental Mutation 'R9218:Tecpr1'

699308

Institutional Source

Beutler Lab

Gene Symbol

Tecpr1

Ensembl Gene

ENSMUSG00000066621

Gene Name

tectonin beta-propeller repeat containing 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144194442-144223615 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 144217231 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 135 (K135E)

Ref Sequence

ENSEMBL: ENSMUSP00000082844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085701]

AlphaFold

Q80VP0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085701
AA Change: K135E

PolyPhen 2 Score 0.696 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: K135E

Domain	Start	End	E-Value	Type
TECPR	23	59	8.98e1	SMART
DysFN	64	125	6.72e-24	SMART
DysFC	137	170	1.89e-9	SMART
TECPR	192	225	1.79e-1	SMART
TECPR	234	270	2.5e-9	SMART
TECPR	279	317	4.99e-9	SMART
TECPR	326	361	2.42e-7	SMART
low complexity region	381	394	N/A	INTRINSIC
PH	614	724	1.69e-2	SMART
TECPR	711	750	1.88e-4	SMART
TECPR	766	800	3.27e-4	SMART
DysFN	821	882	2.95e-20	SMART
DysFC	893	926	1.66e-14	SMART
TECPR	940	974	1.69e1	SMART
TECPR	983	1019	1.45e-5	SMART
TECPR	1028	1065	1.51e-8	SMART
TECPR	1074	1109	1.59e-2	SMART
low complexity region	1125	1137	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

93% (57/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,473,924	T378A	probably damaging	Het
5430419D17Rik	C	T	7: 131,261,999	H1244Y	unknown	Het
Abcb4	A	G	5: 8,927,960	M513V	probably benign	Het
Abhd18	T	C	3: 40,916,766		probably null	Het
Adamtsl4	A	T	3: 95,681,094	Y561*	probably null	Het
Alx4	T	A	2: 93,642,827	F57I	possibly damaging	Het
Ap3b1	A	G	13: 94,448,451		probably null	Het
Arsj	A	C	3: 126,438,465	N287H	probably benign	Het
Cabp4	T	A	19: 4,138,694		probably null	Het
Cdh6	T	C	15: 13,057,470	N255S	probably null	Het
Ctrb1	C	T	8: 111,689,508	V49M	probably damaging	Het
Cts3	A	G	13: 61,568,769	S18P	possibly damaging	Het
Dcst1	A	T	3: 89,365,105	I17N	probably benign	Het
Dennd5a	G	A	7: 109,908,385	H823Y	probably damaging	Het
Dmrt2	T	G	19: 25,673,702	L84R	possibly damaging	Het
Dock9	G	T	14: 121,668,459	T93K	probably damaging	Het
Fsip2	C	T	2: 82,992,718	P6265L	probably damaging	Het
Fxn	T	A	19: 24,262,024	K168M	probably damaging	Het
Hc	A	G	2: 35,032,191	L541P	probably damaging	Het
Hsd3b5	T	C	3: 98,619,038	H364R	probably benign	Het
Il18rap	C	T	1: 40,543,017	T366M	probably benign	Het
Inf2	G	A	12: 112,601,424	D163N	possibly damaging	Het
Iqcd	C	T	5: 120,600,642	P175L	possibly damaging	Het
Iqck	C	T	7: 118,941,679	A267V	probably damaging	Het
Kcnh1	A	T	1: 192,453,630	N66I	unknown	Het
Kif16b	T	A	2: 142,699,663	E1239V	possibly damaging	Het
Mctp1	A	G	13: 76,723,697	D362G	possibly damaging	Het
Muc5ac	T	A	7: 141,807,361	S1470T	probably damaging	Het
Neb	A	G	2: 52,293,626		probably null	Het
Odc1	T	A	12: 17,548,311	L151*	probably null	Het
Olfr1508	A	T	14: 52,463,331	V226E	probably damaging	Het
Olfr562-ps1	T	C	7: 102,782,166	I230T	possibly damaging	Het
Otof	T	A	5: 30,385,125	Q693L	probably benign	Het
Pitpnm2	G	A	5: 124,127,281	S753F	probably damaging	Het
Pkd1l3	C	A	8: 109,655,496	S1632*	probably null	Het
Pkhd1l1	A	G	15: 44,520,726	T1171A	possibly damaging	Het
Plpp2	A	G	10: 79,530,667	F104L	probably damaging	Het
Pmaip1	A	G	18: 66,463,299	R80G	probably damaging	Het
Pms2	G	A	5: 143,931,127	V850I	probably benign	Het
Psmd5	G	T	2: 34,857,782	Q288K	probably benign	Het
Rab37	G	A	11: 115,160,649	R194H	probably damaging	Het
Sds	C	T	5: 120,483,612	A273V	probably damaging	Het
Sema4f	A	G	6: 82,913,499	S776P	probably benign	Het
Sh3tc2	T	C	18: 61,968,030	C65R	probably benign	Het
Siglece	C	T	7: 43,657,738	R275H	possibly damaging	Het
Slc6a12	G	A	6: 121,358,664	A318T	probably damaging	Het
Smcr8	A	T	11: 60,779,879	I618L	probably benign	Het
Stt3a	A	G	9: 36,759,260	F72L	probably damaging	Het
Tmem62	A	G	2: 121,004,743	I516M	probably benign	Het
Tnpo2	C	A	8: 85,049,980	H439N	possibly damaging	Het
Txlnb	C	T	10: 17,842,822	S467F	probably damaging	Het
Tyw5	G	A	1: 57,396,789	P81S	probably damaging	Het
Uhrf1bp1	T	A	17: 27,895,555	C1387S	probably benign	Het
Vamp2	A	G	11: 69,089,759	D51G	possibly damaging	Het
Vmn1r220	T	A	13: 23,184,439	Y29F	probably benign	Het
Vmn2r80	A	G	10: 79,194,436	T699A	possibly damaging	Het
Vps9d1	G	A	8: 123,250,935	T87I	probably benign	Het
Zcchc11	A	T	4: 108,512,886	K661*	probably null	Het
Zfhx3	T	C	8: 108,793,869	V541A	probably benign	Het
Zmym4	A	T	4: 126,915,622	L295Q	probably damaging	Het

Other mutations in Tecpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Tecpr1	APN	5	144208593	critical splice donor site	probably null
IGL01774:Tecpr1	APN	5	144211540	missense	probably damaging	0.97
IGL01960:Tecpr1	APN	5	144216919	missense	probably benign	0.00
IGL01973:Tecpr1	APN	5	144197988	splice site	probably benign
IGL02244:Tecpr1	APN	5	144210003	missense	probably benign
IGL02247:Tecpr1	APN	5	144206554	missense	possibly damaging	0.64
IGL02423:Tecpr1	APN	5	144203487	missense	possibly damaging	0.88
IGL02679:Tecpr1	APN	5	144206546	missense	probably benign	0.28
larghissimo	UTSW	5	144217257	missense	probably damaging	1.00
PIT4531001:Tecpr1	UTSW	5	144214067	missense	probably damaging	0.96
R0121:Tecpr1	UTSW	5	144210199	missense	probably benign	0.02
R0125:Tecpr1	UTSW	5	144197899	missense	probably damaging	1.00
R0194:Tecpr1	UTSW	5	144218517	missense	probably damaging	1.00
R0376:Tecpr1	UTSW	5	144207476	missense	possibly damaging	0.94
R0441:Tecpr1	UTSW	5	144195941	missense	probably benign
R0504:Tecpr1	UTSW	5	144214081	missense	probably damaging	0.99
R0538:Tecpr1	UTSW	5	144206274	missense	probably damaging	0.99
R0586:Tecpr1	UTSW	5	144217401	missense	probably damaging	1.00
R0607:Tecpr1	UTSW	5	144212590	missense	probably damaging	1.00
R0608:Tecpr1	UTSW	5	144211499	missense	probably damaging	1.00
R0656:Tecpr1	UTSW	5	144214053	splice site	probably null
R0835:Tecpr1	UTSW	5	144212592	missense	possibly damaging	0.81
R1080:Tecpr1	UTSW	5	144216929	missense	probably damaging	1.00
R1394:Tecpr1	UTSW	5	144206539	missense	possibly damaging	0.77
R1597:Tecpr1	UTSW	5	144214310	missense	probably benign	0.00
R1663:Tecpr1	UTSW	5	144197944	missense	probably benign	0.17
R1785:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1786:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1833:Tecpr1	UTSW	5	144208608	missense	probably damaging	0.99
R1883:Tecpr1	UTSW	5	144206529	missense	probably benign	0.03
R1988:Tecpr1	UTSW	5	144204697	missense	possibly damaging	0.94
R2130:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2131:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2132:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2133:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2172:Tecpr1	UTSW	5	144196417	missense	probably damaging	1.00
R2172:Tecpr1	UTSW	5	144211456	missense	probably benign	0.10
R2290:Tecpr1	UTSW	5	144214063	missense	probably damaging	0.99
R3691:Tecpr1	UTSW	5	144209979	missense	probably benign	0.10
R4027:Tecpr1	UTSW	5	144206259	missense	probably benign	0.41
R4587:Tecpr1	UTSW	5	144212590	missense	probably damaging	0.96
R4684:Tecpr1	UTSW	5	144207437	missense	probably benign	0.16
R4864:Tecpr1	UTSW	5	144214117	missense	probably benign	0.00
R4932:Tecpr1	UTSW	5	144204658	missense	probably damaging	0.97
R4955:Tecpr1	UTSW	5	144217257	missense	probably damaging	1.00
R5043:Tecpr1	UTSW	5	144197854	splice site	probably null
R5459:Tecpr1	UTSW	5	144207416	missense	probably damaging	1.00
R5579:Tecpr1	UTSW	5	144214344	missense	possibly damaging	0.55
R5677:Tecpr1	UTSW	5	144218633	nonsense	probably null
R5679:Tecpr1	UTSW	5	144207423	missense	possibly damaging	0.69
R5802:Tecpr1	UTSW	5	144206546	missense	probably benign	0.28
R6000:Tecpr1	UTSW	5	144211421	missense	probably benign	0.02
R6022:Tecpr1	UTSW	5	144199191	missense	possibly damaging	0.95
R6114:Tecpr1	UTSW	5	144204640	missense	possibly damaging	0.81
R6251:Tecpr1	UTSW	5	144198576	missense	probably damaging	0.97
R6372:Tecpr1	UTSW	5	144216958	missense	probably damaging	1.00
R6493:Tecpr1	UTSW	5	144209974	missense	probably benign
R7276:Tecpr1	UTSW	5	144217020	nonsense	probably null
R7314:Tecpr1	UTSW	5	144217332	missense	probably damaging	1.00
R7375:Tecpr1	UTSW	5	144208599	missense	possibly damaging	0.68
R7632:Tecpr1	UTSW	5	144218726	missense	probably benign	0.03
R7702:Tecpr1	UTSW	5	144203418	missense	probably damaging	1.00
R8135:Tecpr1	UTSW	5	144198602	missense	probably damaging	0.99
R8406:Tecpr1	UTSW	5	144200840	missense	probably damaging	1.00
R8844:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8856:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8857:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8866:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8903:Tecpr1	UTSW	5	144214027	intron	probably benign
R8926:Tecpr1	UTSW	5	144216962	missense	probably damaging	1.00
R9423:Tecpr1	UTSW	5	144218578	missense	probably damaging	0.98
RF001:Tecpr1	UTSW	5	144217386	missense	probably damaging	0.99
Z1176:Tecpr1	UTSW	5	144218591	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- AAGGTGGGAGCATCATTTGTC -3'
(R):5'- ATCTGGCTCACTCCTAACGC -3'

Sequencing Primer
(F):5'- AGCATCATTTGTCTTGGTGGAAAG -3'
(R):5'- TCAGCGTTGGAACCCCATG -3'

Posted On

2022-02-07