Incidental Mutation 'R9218:Dock9'
ID 699337
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, Zizimin1, B230309H04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9218 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 121542046-121797837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 121668459 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 93 (T93K)
Ref Sequence ENSEMBL: ENSMUSP00000047881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000040700
AA Change: T93K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: T93K

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100299
AA Change: T95K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: T95K

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212181
AA Change: T93K

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000212376
AA Change: T107K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (57/61)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,473,924 T378A probably damaging Het
5430419D17Rik C T 7: 131,261,999 H1244Y unknown Het
Abcb4 A G 5: 8,927,960 M513V probably benign Het
Abhd18 T C 3: 40,916,766 probably null Het
Adamtsl4 A T 3: 95,681,094 Y561* probably null Het
Alx4 T A 2: 93,642,827 F57I possibly damaging Het
Ap3b1 A G 13: 94,448,451 probably null Het
Arsj A C 3: 126,438,465 N287H probably benign Het
Cabp4 T A 19: 4,138,694 probably null Het
Cdh6 T C 15: 13,057,470 N255S probably null Het
Ctrb1 C T 8: 111,689,508 V49M probably damaging Het
Cts3 A G 13: 61,568,769 S18P possibly damaging Het
Dcst1 A T 3: 89,365,105 I17N probably benign Het
Dennd5a G A 7: 109,908,385 H823Y probably damaging Het
Dmrt2 T G 19: 25,673,702 L84R possibly damaging Het
Fsip2 C T 2: 82,992,718 P6265L probably damaging Het
Fxn T A 19: 24,262,024 K168M probably damaging Het
Hc A G 2: 35,032,191 L541P probably damaging Het
Hsd3b5 T C 3: 98,619,038 H364R probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Inf2 G A 12: 112,601,424 D163N possibly damaging Het
Iqcd C T 5: 120,600,642 P175L possibly damaging Het
Iqck C T 7: 118,941,679 A267V probably damaging Het
Kcnh1 A T 1: 192,453,630 N66I unknown Het
Kif16b T A 2: 142,699,663 E1239V possibly damaging Het
Mctp1 A G 13: 76,723,697 D362G possibly damaging Het
Muc5ac T A 7: 141,807,361 S1470T probably damaging Het
Neb A G 2: 52,293,626 probably null Het
Odc1 T A 12: 17,548,311 L151* probably null Het
Olfr1508 A T 14: 52,463,331 V226E probably damaging Het
Olfr562-ps1 T C 7: 102,782,166 I230T possibly damaging Het
Otof T A 5: 30,385,125 Q693L probably benign Het
Pitpnm2 G A 5: 124,127,281 S753F probably damaging Het
Pkd1l3 C A 8: 109,655,496 S1632* probably null Het
Pkhd1l1 A G 15: 44,520,726 T1171A possibly damaging Het
Plpp2 A G 10: 79,530,667 F104L probably damaging Het
Pmaip1 A G 18: 66,463,299 R80G probably damaging Het
Pms2 G A 5: 143,931,127 V850I probably benign Het
Psmd5 G T 2: 34,857,782 Q288K probably benign Het
Rab37 G A 11: 115,160,649 R194H probably damaging Het
Sds C T 5: 120,483,612 A273V probably damaging Het
Sema4f A G 6: 82,913,499 S776P probably benign Het
Sh3tc2 T C 18: 61,968,030 C65R probably benign Het
Siglece C T 7: 43,657,738 R275H possibly damaging Het
Slc6a12 G A 6: 121,358,664 A318T probably damaging Het
Smcr8 A T 11: 60,779,879 I618L probably benign Het
Stt3a A G 9: 36,759,260 F72L probably damaging Het
Tecpr1 T C 5: 144,217,231 K135E possibly damaging Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Tnpo2 C A 8: 85,049,980 H439N possibly damaging Het
Txlnb C T 10: 17,842,822 S467F probably damaging Het
Tyw5 G A 1: 57,396,789 P81S probably damaging Het
Uhrf1bp1 T A 17: 27,895,555 C1387S probably benign Het
Vamp2 A G 11: 69,089,759 D51G possibly damaging Het
Vmn1r220 T A 13: 23,184,439 Y29F probably benign Het
Vmn2r80 A G 10: 79,194,436 T699A possibly damaging Het
Vps9d1 G A 8: 123,250,935 T87I probably benign Het
Zcchc11 A T 4: 108,512,886 K661* probably null Het
Zfhx3 T C 8: 108,793,869 V541A probably benign Het
Zmym4 A T 4: 126,915,622 L295Q probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4258:Dock9 UTSW 14 121581442 missense probably benign 0.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
R8900:Dock9 UTSW 14 121580528 missense probably damaging 1.00
R9069:Dock9 UTSW 14 121628912 missense probably damaging 0.98
R9233:Dock9 UTSW 14 121583369 missense probably benign 0.09
R9236:Dock9 UTSW 14 121639558 missense probably damaging 1.00
R9285:Dock9 UTSW 14 121595600 missense probably benign
R9451:Dock9 UTSW 14 121550189 splice site probably benign
R9461:Dock9 UTSW 14 121605189 missense probably benign 0.05
R9484:Dock9 UTSW 14 121581432 missense probably damaging 1.00
R9517:Dock9 UTSW 14 121591824 missense probably benign 0.07
R9542:Dock9 UTSW 14 121627363 missense probably damaging 1.00
R9694:Dock9 UTSW 14 121581379 missense probably damaging 1.00
R9701:Dock9 UTSW 14 121639571 missense probably benign 0.01
R9703:Dock9 UTSW 14 121544577 makesense probably null
R9726:Dock9 UTSW 14 121597737 missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121640104 missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- TATGCTCTGACAACGTCTCATC -3'
(R):5'- ACCTCGTCTGGAATGGGAAC -3'

Sequencing Primer
(F):5'- CATAAAACCCGCCATTACTTCTTTG -3'
(R):5'- CCTCGTCTGGAATGGGAACTTAGAAG -3'
Posted On 2022-02-07