Incidental Mutation 'R9218:Sh3tc2'
ID 699341
Institutional Source Beutler Lab
Gene Symbol Sh3tc2
Ensembl Gene ENSMUSG00000045629
Gene Name SH3 domain and tetratricopeptide repeats 2
Synonyms D430044G18Rik
Accession Numbers

Genbank: NM_172628

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9218 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 61953075-62015715 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 61968030 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 65 (C65R)
Ref Sequence ENSEMBL: ENSMUSP00000055094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051720]
AlphaFold Q80VA5
Predicted Effect probably benign
Transcript: ENSMUST00000051720
AA Change: C65R

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000055094
Gene: ENSMUSG00000045629
AA Change: C65R

DomainStartEndE-ValueType
coiled coil region 75 101 N/A INTRINSIC
SH3 179 238 1.02e0 SMART
SH3 270 329 6.76e-5 SMART
low complexity region 414 425 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 486 503 N/A INTRINSIC
TPR 529 562 3.24e1 SMART
low complexity region 568 581 N/A INTRINSIC
TPR 837 870 2.66e0 SMART
Blast:TPR 877 910 2e-7 BLAST
low complexity region 1011 1025 N/A INTRINSIC
Blast:TPR 1045 1078 1e-12 BLAST
Blast:TPR 1127 1158 3e-7 BLAST
TPR 1167 1200 1.04e-2 SMART
Blast:TPR 1211 1235 5e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 93% (57/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two N-terminal Src homology 3 (SH3) domains and 10 tetratricopeptide repeat (TPR) motifs, and is a member of a small gene family. The gene product has been proposed to be an adapter or docking molecule. Mutations in this gene result in autosomal recessive Charcot-Marie-Tooth disease type 4C, a childhood-onset neurodegenerative disease characterized by demyelination of motor and sensory neurons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomyelination of peripheral axons with reduced conduction velocity and limb grasping. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, other(3)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,473,924 T378A probably damaging Het
5430419D17Rik C T 7: 131,261,999 H1244Y unknown Het
Abcb4 A G 5: 8,927,960 M513V probably benign Het
Abhd18 T C 3: 40,916,766 probably null Het
Adamtsl4 A T 3: 95,681,094 Y561* probably null Het
Alx4 T A 2: 93,642,827 F57I possibly damaging Het
Ap3b1 A G 13: 94,448,451 probably null Het
Arsj A C 3: 126,438,465 N287H probably benign Het
Cabp4 T A 19: 4,138,694 probably null Het
Cdh6 T C 15: 13,057,470 N255S probably null Het
Ctrb1 C T 8: 111,689,508 V49M probably damaging Het
Cts3 A G 13: 61,568,769 S18P possibly damaging Het
Dcst1 A T 3: 89,365,105 I17N probably benign Het
Dennd5a G A 7: 109,908,385 H823Y probably damaging Het
Dmrt2 T G 19: 25,673,702 L84R possibly damaging Het
Dock9 G T 14: 121,668,459 T93K probably damaging Het
Fsip2 C T 2: 82,992,718 P6265L probably damaging Het
Fxn T A 19: 24,262,024 K168M probably damaging Het
Hc A G 2: 35,032,191 L541P probably damaging Het
Hsd3b5 T C 3: 98,619,038 H364R probably benign Het
Il18rap C T 1: 40,543,017 T366M probably benign Het
Inf2 G A 12: 112,601,424 D163N possibly damaging Het
Iqcd C T 5: 120,600,642 P175L possibly damaging Het
Iqck C T 7: 118,941,679 A267V probably damaging Het
Kcnh1 A T 1: 192,453,630 N66I unknown Het
Kif16b T A 2: 142,699,663 E1239V possibly damaging Het
Mctp1 A G 13: 76,723,697 D362G possibly damaging Het
Muc5ac T A 7: 141,807,361 S1470T probably damaging Het
Neb A G 2: 52,293,626 probably null Het
Odc1 T A 12: 17,548,311 L151* probably null Het
Olfr1508 A T 14: 52,463,331 V226E probably damaging Het
Olfr562-ps1 T C 7: 102,782,166 I230T possibly damaging Het
Otof T A 5: 30,385,125 Q693L probably benign Het
Pitpnm2 G A 5: 124,127,281 S753F probably damaging Het
Pkd1l3 C A 8: 109,655,496 S1632* probably null Het
Pkhd1l1 A G 15: 44,520,726 T1171A possibly damaging Het
Plpp2 A G 10: 79,530,667 F104L probably damaging Het
Pmaip1 A G 18: 66,463,299 R80G probably damaging Het
Pms2 G A 5: 143,931,127 V850I probably benign Het
Psmd5 G T 2: 34,857,782 Q288K probably benign Het
Rab37 G A 11: 115,160,649 R194H probably damaging Het
Sds C T 5: 120,483,612 A273V probably damaging Het
Sema4f A G 6: 82,913,499 S776P probably benign Het
Siglece C T 7: 43,657,738 R275H possibly damaging Het
Slc6a12 G A 6: 121,358,664 A318T probably damaging Het
Smcr8 A T 11: 60,779,879 I618L probably benign Het
Stt3a A G 9: 36,759,260 F72L probably damaging Het
Tecpr1 T C 5: 144,217,231 K135E possibly damaging Het
Tmem62 A G 2: 121,004,743 I516M probably benign Het
Tnpo2 C A 8: 85,049,980 H439N possibly damaging Het
Txlnb C T 10: 17,842,822 S467F probably damaging Het
Tyw5 G A 1: 57,396,789 P81S probably damaging Het
Uhrf1bp1 T A 17: 27,895,555 C1387S probably benign Het
Vamp2 A G 11: 69,089,759 D51G possibly damaging Het
Vmn1r220 T A 13: 23,184,439 Y29F probably benign Het
Vmn2r80 A G 10: 79,194,436 T699A possibly damaging Het
Vps9d1 G A 8: 123,250,935 T87I probably benign Het
Zcchc11 A T 4: 108,512,886 K661* probably null Het
Zfhx3 T C 8: 108,793,869 V541A probably benign Het
Zmym4 A T 4: 126,915,622 L295Q probably damaging Het
Other mutations in Sh3tc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Sh3tc2 APN 18 61989511 missense probably damaging 1.00
IGL01523:Sh3tc2 APN 18 61990883 missense probably benign 0.00
IGL02036:Sh3tc2 APN 18 62014907 missense probably benign 0.17
IGL02189:Sh3tc2 APN 18 61990622 missense probably benign 0.00
IGL02555:Sh3tc2 APN 18 61990237 missense probably damaging 0.99
IGL02827:Sh3tc2 APN 18 62013159 missense probably benign 0.34
IGL03033:Sh3tc2 APN 18 61974478 missense possibly damaging 0.90
IGL03040:Sh3tc2 APN 18 61989410 missense probably benign 0.00
IGL03062:Sh3tc2 APN 18 62011880 missense probably damaging 1.00
IGL03386:Sh3tc2 APN 18 61973311 missense probably benign 0.39
3-1:Sh3tc2 UTSW 18 61991138 missense probably damaging 1.00
R1085:Sh3tc2 UTSW 18 62014996 missense probably benign 0.01
R1166:Sh3tc2 UTSW 18 61991176 missense probably damaging 0.99
R1182:Sh3tc2 UTSW 18 61968100 missense probably benign 0.17
R1521:Sh3tc2 UTSW 18 62008488 missense probably damaging 0.96
R1636:Sh3tc2 UTSW 18 61989721 missense probably damaging 0.98
R1872:Sh3tc2 UTSW 18 62011883 missense probably damaging 1.00
R1884:Sh3tc2 UTSW 18 62008575 missense probably damaging 1.00
R1964:Sh3tc2 UTSW 18 61991155 nonsense probably null
R2034:Sh3tc2 UTSW 18 61987666 missense probably damaging 1.00
R2046:Sh3tc2 UTSW 18 61990843 missense probably benign
R2113:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R2363:Sh3tc2 UTSW 18 61990895 missense probably benign 0.07
R2940:Sh3tc2 UTSW 18 61989686 missense probably damaging 1.00
R2979:Sh3tc2 UTSW 18 61989485 missense probably damaging 1.00
R3717:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R3718:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R4334:Sh3tc2 UTSW 18 61990321 missense probably damaging 1.00
R4454:Sh3tc2 UTSW 18 62007773 missense probably damaging 1.00
R4503:Sh3tc2 UTSW 18 61974623 missense probably damaging 0.96
R4515:Sh3tc2 UTSW 18 61987693 splice site probably null
R4659:Sh3tc2 UTSW 18 61974509 missense probably benign 0.00
R4859:Sh3tc2 UTSW 18 62013093 missense probably benign 0.00
R4901:Sh3tc2 UTSW 18 61990435 missense probably benign 0.03
R5033:Sh3tc2 UTSW 18 62014891 splice site probably null
R5269:Sh3tc2 UTSW 18 61975613 missense probably benign 0.00
R5439:Sh3tc2 UTSW 18 61989633 nonsense probably null
R5467:Sh3tc2 UTSW 18 61990688 missense possibly damaging 0.81
R5468:Sh3tc2 UTSW 18 61973431 critical splice donor site probably null
R5527:Sh3tc2 UTSW 18 62011861 missense probably benign 0.00
R5829:Sh3tc2 UTSW 18 61990915 missense probably benign 0.19
R5880:Sh3tc2 UTSW 18 61973311 missense probably benign 0.39
R5948:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R5951:Sh3tc2 UTSW 18 61990007 missense probably damaging 1.00
R5973:Sh3tc2 UTSW 18 61977904 missense probably benign 0.06
R5995:Sh3tc2 UTSW 18 61990010 missense probably damaging 0.96
R6309:Sh3tc2 UTSW 18 61968010 missense probably damaging 0.98
R6339:Sh3tc2 UTSW 18 61975571 nonsense probably null
R6648:Sh3tc2 UTSW 18 62015040 missense probably benign 0.00
R6723:Sh3tc2 UTSW 18 61977954 missense probably damaging 1.00
R6752:Sh3tc2 UTSW 18 61961037 missense probably benign 0.00
R7211:Sh3tc2 UTSW 18 61989403 missense probably benign
R7367:Sh3tc2 UTSW 18 61989506 missense probably benign 0.00
R7664:Sh3tc2 UTSW 18 62014971 nonsense probably null
R7727:Sh3tc2 UTSW 18 61989580 missense probably benign 0.02
R7823:Sh3tc2 UTSW 18 61953117 start codon destroyed probably null 1.00
R8191:Sh3tc2 UTSW 18 61973358 missense probably damaging 1.00
R8204:Sh3tc2 UTSW 18 61953129 missense probably damaging 1.00
R8219:Sh3tc2 UTSW 18 62011861 missense probably benign 0.00
R8260:Sh3tc2 UTSW 18 62013066 missense probably damaging 1.00
R8413:Sh3tc2 UTSW 18 61990802 missense probably damaging 1.00
R8413:Sh3tc2 UTSW 18 62015071 missense probably benign 0.30
R9034:Sh3tc2 UTSW 18 61974500 missense probably benign 0.07
R9043:Sh3tc2 UTSW 18 61989890 missense possibly damaging 0.89
R9249:Sh3tc2 UTSW 18 61974527 missense possibly damaging 0.52
Z1176:Sh3tc2 UTSW 18 61989909 nonsense probably null
Z1177:Sh3tc2 UTSW 18 61989688 missense probably damaging 1.00
Z1177:Sh3tc2 UTSW 18 61991318 missense probably benign 0.09
Z1177:Sh3tc2 UTSW 18 62014991 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTTGAAAGGGAGCTTGGACG -3'
(R):5'- TTCACTCATTCCTGTTAGGCAG -3'

Sequencing Primer
(F):5'- AGCTTGGACGCTCCTTTAAC -3'
(R):5'- TTAGGCAGAACATATGAACTTAACCC -3'
Posted On 2022-02-07