Mutagenetix > Incidental Mutation

Incidental Mutation 'R9218:Sh3tc2'

699341

Institutional Source

Beutler Lab

Gene Symbol

Sh3tc2

Ensembl Gene

ENSMUSG00000045629

Gene Name

SH3 domain and tetratricopeptide repeats 2

Synonyms

D430044G18Rik

Accession Numbers

Genbank: NM_172628

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9218 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61953075-62015715 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61968030 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 65 (C65R)

Ref Sequence

ENSEMBL: ENSMUSP00000055094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051720]

AlphaFold

Q80VA5

Predicted Effect

probably benign
Transcript: ENSMUST00000051720
AA Change: C65R

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000055094
Gene: ENSMUSG00000045629
AA Change: C65R

Domain	Start	End	E-Value	Type
coiled coil region	75	101	N/A	INTRINSIC
SH3	179	238	1.02e0	SMART
SH3	270	329	6.76e-5	SMART
low complexity region	414	425	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	486	503	N/A	INTRINSIC
TPR	529	562	3.24e1	SMART
low complexity region	568	581	N/A	INTRINSIC
TPR	837	870	2.66e0	SMART
Blast:TPR	877	910	2e-7	BLAST
low complexity region	1011	1025	N/A	INTRINSIC
Blast:TPR	1045	1078	1e-12	BLAST
Blast:TPR	1127	1158	3e-7	BLAST
TPR	1167	1200	1.04e-2	SMART
Blast:TPR	1211	1235	5e-7	BLAST

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

93% (57/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two N-terminal Src homology 3 (SH3) domains and 10 tetratricopeptide repeat (TPR) motifs, and is a member of a small gene family. The gene product has been proposed to be an adapter or docking molecule. Mutations in this gene result in autosomal recessive Charcot-Marie-Tooth disease type 4C, a childhood-onset neurodegenerative disease characterized by demyelination of motor and sensory neurons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomyelination of peripheral axons with reduced conduction velocity and limb grasping. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,473,924	T378A	probably damaging	Het
5430419D17Rik	C	T	7: 131,261,999	H1244Y	unknown	Het
Abcb4	A	G	5: 8,927,960	M513V	probably benign	Het
Abhd18	T	C	3: 40,916,766		probably null	Het
Adamtsl4	A	T	3: 95,681,094	Y561*	probably null	Het
Alx4	T	A	2: 93,642,827	F57I	possibly damaging	Het
Ap3b1	A	G	13: 94,448,451		probably null	Het
Arsj	A	C	3: 126,438,465	N287H	probably benign	Het
Cabp4	T	A	19: 4,138,694		probably null	Het
Cdh6	T	C	15: 13,057,470	N255S	probably null	Het
Ctrb1	C	T	8: 111,689,508	V49M	probably damaging	Het
Cts3	A	G	13: 61,568,769	S18P	possibly damaging	Het
Dcst1	A	T	3: 89,365,105	I17N	probably benign	Het
Dennd5a	G	A	7: 109,908,385	H823Y	probably damaging	Het
Dmrt2	T	G	19: 25,673,702	L84R	possibly damaging	Het
Dock9	G	T	14: 121,668,459	T93K	probably damaging	Het
Fsip2	C	T	2: 82,992,718	P6265L	probably damaging	Het
Fxn	T	A	19: 24,262,024	K168M	probably damaging	Het
Hc	A	G	2: 35,032,191	L541P	probably damaging	Het
Hsd3b5	T	C	3: 98,619,038	H364R	probably benign	Het
Il18rap	C	T	1: 40,543,017	T366M	probably benign	Het
Inf2	G	A	12: 112,601,424	D163N	possibly damaging	Het
Iqcd	C	T	5: 120,600,642	P175L	possibly damaging	Het
Iqck	C	T	7: 118,941,679	A267V	probably damaging	Het
Kcnh1	A	T	1: 192,453,630	N66I	unknown	Het
Kif16b	T	A	2: 142,699,663	E1239V	possibly damaging	Het
Mctp1	A	G	13: 76,723,697	D362G	possibly damaging	Het
Muc5ac	T	A	7: 141,807,361	S1470T	probably damaging	Het
Neb	A	G	2: 52,293,626		probably null	Het
Odc1	T	A	12: 17,548,311	L151*	probably null	Het
Olfr1508	A	T	14: 52,463,331	V226E	probably damaging	Het
Olfr562-ps1	T	C	7: 102,782,166	I230T	possibly damaging	Het
Otof	T	A	5: 30,385,125	Q693L	probably benign	Het
Pitpnm2	G	A	5: 124,127,281	S753F	probably damaging	Het
Pkd1l3	C	A	8: 109,655,496	S1632*	probably null	Het
Pkhd1l1	A	G	15: 44,520,726	T1171A	possibly damaging	Het
Plpp2	A	G	10: 79,530,667	F104L	probably damaging	Het
Pmaip1	A	G	18: 66,463,299	R80G	probably damaging	Het
Pms2	G	A	5: 143,931,127	V850I	probably benign	Het
Psmd5	G	T	2: 34,857,782	Q288K	probably benign	Het
Rab37	G	A	11: 115,160,649	R194H	probably damaging	Het
Sds	C	T	5: 120,483,612	A273V	probably damaging	Het
Sema4f	A	G	6: 82,913,499	S776P	probably benign	Het
Siglece	C	T	7: 43,657,738	R275H	possibly damaging	Het
Slc6a12	G	A	6: 121,358,664	A318T	probably damaging	Het
Smcr8	A	T	11: 60,779,879	I618L	probably benign	Het
Stt3a	A	G	9: 36,759,260	F72L	probably damaging	Het
Tecpr1	T	C	5: 144,217,231	K135E	possibly damaging	Het
Tmem62	A	G	2: 121,004,743	I516M	probably benign	Het
Tnpo2	C	A	8: 85,049,980	H439N	possibly damaging	Het
Txlnb	C	T	10: 17,842,822	S467F	probably damaging	Het
Tyw5	G	A	1: 57,396,789	P81S	probably damaging	Het
Uhrf1bp1	T	A	17: 27,895,555	C1387S	probably benign	Het
Vamp2	A	G	11: 69,089,759	D51G	possibly damaging	Het
Vmn1r220	T	A	13: 23,184,439	Y29F	probably benign	Het
Vmn2r80	A	G	10: 79,194,436	T699A	possibly damaging	Het
Vps9d1	G	A	8: 123,250,935	T87I	probably benign	Het
Zcchc11	A	T	4: 108,512,886	K661*	probably null	Het
Zfhx3	T	C	8: 108,793,869	V541A	probably benign	Het
Zmym4	A	T	4: 126,915,622	L295Q	probably damaging	Het

Other mutations in Sh3tc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01146:Sh3tc2	APN	18	61989511	missense	probably damaging	1.00
IGL01523:Sh3tc2	APN	18	61990883	missense	probably benign	0.00
IGL02036:Sh3tc2	APN	18	62014907	missense	probably benign	0.17
IGL02189:Sh3tc2	APN	18	61990622	missense	probably benign	0.00
IGL02555:Sh3tc2	APN	18	61990237	missense	probably damaging	0.99
IGL02827:Sh3tc2	APN	18	62013159	missense	probably benign	0.34
IGL03033:Sh3tc2	APN	18	61974478	missense	possibly damaging	0.90
IGL03040:Sh3tc2	APN	18	61989410	missense	probably benign	0.00
IGL03062:Sh3tc2	APN	18	62011880	missense	probably damaging	1.00
IGL03386:Sh3tc2	APN	18	61973311	missense	probably benign	0.39
3-1:Sh3tc2	UTSW	18	61991138	missense	probably damaging	1.00
R1085:Sh3tc2	UTSW	18	62014996	missense	probably benign	0.01
R1166:Sh3tc2	UTSW	18	61991176	missense	probably damaging	0.99
R1182:Sh3tc2	UTSW	18	61968100	missense	probably benign	0.17
R1521:Sh3tc2	UTSW	18	62008488	missense	probably damaging	0.96
R1636:Sh3tc2	UTSW	18	61989721	missense	probably damaging	0.98
R1872:Sh3tc2	UTSW	18	62011883	missense	probably damaging	1.00
R1884:Sh3tc2	UTSW	18	62008575	missense	probably damaging	1.00
R1964:Sh3tc2	UTSW	18	61991155	nonsense	probably null
R2034:Sh3tc2	UTSW	18	61987666	missense	probably damaging	1.00
R2046:Sh3tc2	UTSW	18	61990843	missense	probably benign
R2113:Sh3tc2	UTSW	18	62013105	missense	probably damaging	1.00
R2363:Sh3tc2	UTSW	18	61990895	missense	probably benign	0.07
R2940:Sh3tc2	UTSW	18	61989686	missense	probably damaging	1.00
R2979:Sh3tc2	UTSW	18	61989485	missense	probably damaging	1.00
R3717:Sh3tc2	UTSW	18	61990343	missense	probably benign	0.04
R3718:Sh3tc2	UTSW	18	61990343	missense	probably benign	0.04
R4334:Sh3tc2	UTSW	18	61990321	missense	probably damaging	1.00
R4454:Sh3tc2	UTSW	18	62007773	missense	probably damaging	1.00
R4503:Sh3tc2	UTSW	18	61974623	missense	probably damaging	0.96
R4515:Sh3tc2	UTSW	18	61987693	splice site	probably null
R4659:Sh3tc2	UTSW	18	61974509	missense	probably benign	0.00
R4859:Sh3tc2	UTSW	18	62013093	missense	probably benign	0.00
R4901:Sh3tc2	UTSW	18	61990435	missense	probably benign	0.03
R5033:Sh3tc2	UTSW	18	62014891	splice site	probably null
R5269:Sh3tc2	UTSW	18	61975613	missense	probably benign	0.00
R5439:Sh3tc2	UTSW	18	61989633	nonsense	probably null
R5467:Sh3tc2	UTSW	18	61990688	missense	possibly damaging	0.81
R5468:Sh3tc2	UTSW	18	61973431	critical splice donor site	probably null
R5527:Sh3tc2	UTSW	18	62011861	missense	probably benign	0.00
R5829:Sh3tc2	UTSW	18	61990915	missense	probably benign	0.19
R5880:Sh3tc2	UTSW	18	61973311	missense	probably benign	0.39
R5948:Sh3tc2	UTSW	18	62013105	missense	probably damaging	1.00
R5951:Sh3tc2	UTSW	18	61990007	missense	probably damaging	1.00
R5973:Sh3tc2	UTSW	18	61977904	missense	probably benign	0.06
R5995:Sh3tc2	UTSW	18	61990010	missense	probably damaging	0.96
R6309:Sh3tc2	UTSW	18	61968010	missense	probably damaging	0.98
R6339:Sh3tc2	UTSW	18	61975571	nonsense	probably null
R6648:Sh3tc2	UTSW	18	62015040	missense	probably benign	0.00
R6723:Sh3tc2	UTSW	18	61977954	missense	probably damaging	1.00
R6752:Sh3tc2	UTSW	18	61961037	missense	probably benign	0.00
R7211:Sh3tc2	UTSW	18	61989403	missense	probably benign
R7367:Sh3tc2	UTSW	18	61989506	missense	probably benign	0.00
R7664:Sh3tc2	UTSW	18	62014971	nonsense	probably null
R7727:Sh3tc2	UTSW	18	61989580	missense	probably benign	0.02
R7823:Sh3tc2	UTSW	18	61953117	start codon destroyed	probably null	1.00
R8191:Sh3tc2	UTSW	18	61973358	missense	probably damaging	1.00
R8204:Sh3tc2	UTSW	18	61953129	missense	probably damaging	1.00
R8219:Sh3tc2	UTSW	18	62011861	missense	probably benign	0.00
R8260:Sh3tc2	UTSW	18	62013066	missense	probably damaging	1.00
R8413:Sh3tc2	UTSW	18	61990802	missense	probably damaging	1.00
R8413:Sh3tc2	UTSW	18	62015071	missense	probably benign	0.30
R9034:Sh3tc2	UTSW	18	61974500	missense	probably benign	0.07
R9043:Sh3tc2	UTSW	18	61989890	missense	possibly damaging	0.89
R9249:Sh3tc2	UTSW	18	61974527	missense	possibly damaging	0.52
Z1176:Sh3tc2	UTSW	18	61989909	nonsense	probably null
Z1177:Sh3tc2	UTSW	18	61989688	missense	probably damaging	1.00
Z1177:Sh3tc2	UTSW	18	61991318	missense	probably benign	0.09
Z1177:Sh3tc2	UTSW	18	62014991	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CTTGAAAGGGAGCTTGGACG -3'
(R):5'- TTCACTCATTCCTGTTAGGCAG -3'

Sequencing Primer
(F):5'- AGCTTGGACGCTCCTTTAAC -3'
(R):5'- TTAGGCAGAACATATGAACTTAACCC -3'

Posted On

2022-02-07