Incidental Mutation 'R9219:Nlrp4e'
ID 699364
Institutional Source Beutler Lab
Gene Symbol Nlrp4e
Ensembl Gene ENSMUSG00000045693
Gene Name NLR family, pyrin domain containing 4E
Synonyms 4930406H16Rik, Nalp4e, Nalp-epsilon
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9219 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 23301192-23362277 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23321516 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 476 (V476A)
Ref Sequence ENSEMBL: ENSMUSP00000075794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076470]
AlphaFold Q66X19
Predicted Effect possibly damaging
Transcript: ENSMUST00000076470
AA Change: V476A

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075794
Gene: ENSMUSG00000045693
AA Change: V476A

DomainStartEndE-ValueType
PYRIN 6 89 1.43e-35 SMART
Pfam:NACHT 148 317 1.3e-39 PFAM
LRR 689 716 1.87e1 SMART
LRR 718 745 7.74e0 SMART
LRR 746 772 2.5e1 SMART
LRR 774 801 2.67e1 SMART
LRR 802 829 6.48e-1 SMART
LRR 831 858 2.03e0 SMART
LRR 859 886 2.88e-6 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 1.02e2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alx1 A T 10: 103,022,260 Y193N probably damaging Het
Cmtm2a A G 8: 104,281,469 F116S probably damaging Het
Dennd4a A T 9: 64,889,094 M801L probably damaging Het
Disp3 A G 4: 148,249,860 V992A possibly damaging Het
Dopey2 C A 16: 93,770,296 R1322S probably damaging Het
Dusp7 T C 9: 106,371,013 V280A probably damaging Het
Fam208a T A 14: 27,464,387 Y848N possibly damaging Het
Flg A G 3: 93,291,099 E245G possibly damaging Het
Garnl3 A G 2: 33,085,886 S68P probably damaging Het
Gm11639 A C 11: 104,945,865 S3560R unknown Het
Gm13084 G A 4: 143,810,733 R343C probably benign Het
Gm4858 A G 3: 93,074,224 D109G probably damaging Het
Grin1 T C 2: 25,297,666 T582A possibly damaging Het
Hectd1 A G 12: 51,753,829 C2069R probably damaging Het
Herc3 T A 6: 58,894,567 I867K probably benign Het
Hmcn1 A T 1: 150,719,093 probably null Het
Igkv4-54 T A 6: 69,631,705 M77L probably benign Het
Kcnmb4 G C 10: 116,473,467 R19G probably damaging Het
Lamb3 A G 1: 193,327,924 T282A probably damaging Het
Lrrc58 T A 16: 37,868,818 L108Q probably damaging Het
Macf1 C A 4: 123,407,761 A983S possibly damaging Het
Mcf2l A T 8: 13,011,383 N794I probably damaging Het
Mroh3 A G 1: 136,191,639 F469L probably benign Het
Muc5ac T A 7: 141,817,063 C3244* probably null Het
Myo16 G T 8: 10,442,236 R726L unknown Het
Naaa A G 5: 92,278,005 V43A probably damaging Het
Naip2 A G 13: 100,160,705 V941A probably benign Het
Nbea AC A 3: 56,090,972 probably null Het
Olfr382 A C 11: 73,516,975 S75A probably damaging Het
Pcdh20 T G 14: 88,468,819 R348S probably benign Het
Pom121l12 C A 11: 14,599,809 P172T probably damaging Het
Prkd3 A G 17: 78,966,199 S543P probably benign Het
Ptpn13 A G 5: 103,597,766 Q2446R probably benign Het
Qrich2 A C 11: 116,445,074 S345A possibly damaging Het
Ryr3 T C 2: 112,912,239 E498G possibly damaging Het
Sh3d19 A G 3: 86,123,200 T675A possibly damaging Het
Ubl3 T C 5: 148,506,460 E96G probably damaging Het
Zfp780b T C 7: 27,964,381 T250A probably benign Het
Zfp871 A T 17: 32,774,940 N420K probably benign Het
Zfp949 C T 9: 88,569,670 T431M probably damaging Het
Other mutations in Nlrp4e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Nlrp4e APN 7 23343140 missense probably damaging 1.00
IGL00833:Nlrp4e APN 7 23340471 missense probably benign 0.00
IGL01017:Nlrp4e APN 7 23321667 missense possibly damaging 0.93
IGL01025:Nlrp4e APN 7 23353161 splice site probably benign
IGL01815:Nlrp4e APN 7 23321438 missense probably benign 0.02
IGL01924:Nlrp4e APN 7 23320830 nonsense probably null
IGL02245:Nlrp4e APN 7 23320875 missense probably damaging 1.00
IGL02745:Nlrp4e APN 7 23321291 missense probably damaging 1.00
IGL02746:Nlrp4e APN 7 23321839 missense probably benign 0.00
IGL02987:Nlrp4e APN 7 23301433 missense probably damaging 1.00
IGL02997:Nlrp4e APN 7 23301374 missense probably benign 0.04
IGL03193:Nlrp4e APN 7 23320826 missense probably damaging 1.00
IGL03304:Nlrp4e APN 7 23353343 critical splice donor site probably null
IGL03352:Nlrp4e APN 7 23320826 missense probably damaging 1.00
R0389:Nlrp4e UTSW 7 23355203 missense probably damaging 0.98
R1028:Nlrp4e UTSW 7 23321744 missense probably damaging 1.00
R1163:Nlrp4e UTSW 7 23320972 missense probably benign 0.03
R1269:Nlrp4e UTSW 7 23353338 missense possibly damaging 0.95
R1400:Nlrp4e UTSW 7 23321660 missense possibly damaging 0.93
R1497:Nlrp4e UTSW 7 23320372 missense probably benign 0.00
R1518:Nlrp4e UTSW 7 23321843 missense probably benign 0.33
R1716:Nlrp4e UTSW 7 23321033 missense possibly damaging 0.56
R1727:Nlrp4e UTSW 7 23320995 missense probably benign 0.01
R1998:Nlrp4e UTSW 7 23321246 missense probably benign 0.00
R2177:Nlrp4e UTSW 7 23355261 missense probably benign 0.00
R3724:Nlrp4e UTSW 7 23321377 missense probably benign 0.28
R3767:Nlrp4e UTSW 7 23340563 missense probably damaging 1.00
R3795:Nlrp4e UTSW 7 23320803 missense probably benign 0.35
R4387:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4387:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4388:Nlrp4e UTSW 7 23301477 missense probably benign 0.00
R4388:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4389:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4403:Nlrp4e UTSW 7 23321463 nonsense probably null
R4444:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4486:Nlrp4e UTSW 7 23321227 missense probably benign 0.01
R4547:Nlrp4e UTSW 7 23336866 missense probably benign 0.00
R4553:Nlrp4e UTSW 7 23320979 missense probably benign
R4666:Nlrp4e UTSW 7 23336780 nonsense probably null
R4721:Nlrp4e UTSW 7 23321096 missense possibly damaging 0.84
R4728:Nlrp4e UTSW 7 23321564 missense probably benign
R4758:Nlrp4e UTSW 7 23320618 missense probably benign 0.17
R4775:Nlrp4e UTSW 7 23343100 missense probably benign 0.14
R4830:Nlrp4e UTSW 7 23336740 missense probably benign 0.03
R4954:Nlrp4e UTSW 7 23361893 nonsense probably null
R5277:Nlrp4e UTSW 7 23321438 missense probably benign 0.02
R5352:Nlrp4e UTSW 7 23353173 missense probably benign 0.26
R5521:Nlrp4e UTSW 7 23321765 missense probably benign 0.00
R5528:Nlrp4e UTSW 7 23336891 missense probably benign 0.07
R5537:Nlrp4e UTSW 7 23320489 missense probably benign 0.00
R5584:Nlrp4e UTSW 7 23321177 missense probably benign
R5683:Nlrp4e UTSW 7 23353272 missense probably damaging 0.99
R6160:Nlrp4e UTSW 7 23321306 missense probably damaging 0.99
R6313:Nlrp4e UTSW 7 23353172 missense probably benign
R6427:Nlrp4e UTSW 7 23320633 missense possibly damaging 0.48
R6647:Nlrp4e UTSW 7 23321315 missense probably benign 0.00
R6929:Nlrp4e UTSW 7 23336731 critical splice acceptor site probably null
R7307:Nlrp4e UTSW 7 23321528 missense probably benign 0.07
R7792:Nlrp4e UTSW 7 23321757 missense possibly damaging 0.60
R8169:Nlrp4e UTSW 7 23320506 missense probably benign 0.06
R8445:Nlrp4e UTSW 7 23340540 missense probably benign 0.00
R8487:Nlrp4e UTSW 7 23321558 missense probably benign 0.00
R8906:Nlrp4e UTSW 7 23321131 missense possibly damaging 0.88
R9124:Nlrp4e UTSW 7 23320978 missense probably benign
R9167:Nlrp4e UTSW 7 23340526 missense probably benign 0.00
R9181:Nlrp4e UTSW 7 23361845 nonsense probably null
R9229:Nlrp4e UTSW 7 23321374 missense probably benign 0.00
R9321:Nlrp4e UTSW 7 23321330 missense probably benign
R9323:Nlrp4e UTSW 7 23321330 missense probably benign
R9325:Nlrp4e UTSW 7 23321330 missense probably benign
R9379:Nlrp4e UTSW 7 23321330 missense probably benign
R9380:Nlrp4e UTSW 7 23321330 missense probably benign
R9448:Nlrp4e UTSW 7 23301531 missense probably benign
X0022:Nlrp4e UTSW 7 23343119 missense probably damaging 1.00
X0025:Nlrp4e UTSW 7 23343178 missense possibly damaging 0.91
X0026:Nlrp4e UTSW 7 23355223 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GCTCTCAGGAGAAATGGGATC -3'
(R):5'- ACAGCTTCATGCCATCTATCTG -3'

Sequencing Primer
(F):5'- GGGATCATGGACTCTGATATCTCCAC -3'
(R):5'- CCACTTATGGTTTCCAGGCAC -3'
Posted On 2022-02-07