Incidental Mutation 'R9220:Wdr35'
ID 699418
Institutional Source Beutler Lab
Gene Symbol Wdr35
Ensembl Gene ENSMUSG00000066643
Gene Name WD repeat domain 35
Synonyms 4930459M12Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9220 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 8973892-9028847 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8986000 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 257 (V257E)
Ref Sequence ENSEMBL: ENSMUSP00000082895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085745] [ENSMUST00000111113] [ENSMUST00000160329]
AlphaFold Q8BND3
Predicted Effect possibly damaging
Transcript: ENSMUST00000085745
AA Change: V257E

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000082895
Gene: ENSMUSG00000066643
AA Change: V257E

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 465 530 4e-15 BLAST
Blast:WD40 533 571 1e-14 BLAST
low complexity region 1069 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111113
AA Change: V257E

PolyPhen 2 Score 0.305 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106742
Gene: ENSMUSG00000066643
AA Change: V257E

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
WD40 147 184 1.06e2 SMART
Blast:WD40 246 289 6e-18 BLAST
Blast:WD40 292 330 2e-12 BLAST
Blast:WD40 454 519 4e-15 BLAST
Blast:WD40 522 560 2e-14 BLAST
low complexity region 1058 1067 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160329
SMART Domains Protein: ENSMUSP00000124285
Gene: ENSMUSG00000066643

DomainStartEndE-ValueType
WD40 5 42 8.25e0 SMART
WD40 60 99 3.21e-1 SMART
WD40 104 143 2.21e1 SMART
low complexity region 172 186 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Two patients with Sensenbrenner syndrome / cranioectodermal dysplasia (CED) were identified with mutations in this gene, consistent with a possible ciliary function.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for an ENU induced mutation exhibit mid-gestation lethality, heart development defects, turning defects, polysyndactyly, hypoplastic lungs, tracheoesophageal fistula, herniated diaphragm and absent embryonic cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,520 I103V probably benign Het
AF529169 T A 9: 89,602,345 D333V probably damaging Het
Afg3l2 T G 18: 67,429,196 I270L probably benign Het
Akap6 A T 12: 53,140,449 I1549F possibly damaging Het
Ank2 T C 3: 126,943,437 T2933A unknown Het
Atp1a3 C A 7: 24,997,200 E309* probably null Het
B4galt2 T C 4: 117,877,202 Y250C probably damaging Het
Bcl2l13 C A 6: 120,870,774 T129K possibly damaging Het
Clp1 A T 2: 84,723,732 H364Q probably damaging Het
Ddx27 T C 2: 167,029,513 V510A probably benign Het
Dicer1 A G 12: 104,713,156 C521R probably damaging Het
Dnah10 A T 5: 124,794,373 I2486F probably benign Het
Eml1 C A 12: 108,514,443 C389* probably null Het
Fabp6 C T 11: 43,598,745 G23D probably benign Het
Fam3b A T 16: 97,500,911 S38T probably benign Het
Fsd1l A T 4: 53,679,799 K166* probably null Het
Galc A G 12: 98,254,264 S115P probably damaging Het
Gm498 G T 7: 143,881,165 probably null Het
Gpn1 G A 5: 31,507,540 A303T probably benign Het
Grid2 A T 6: 63,908,904 S95C probably damaging Het
Helz T A 11: 107,670,047 S1312T probably benign Het
Matn2 T C 15: 34,410,179 F506L possibly damaging Het
Mcemp1 A G 8: 3,667,512 S148G probably benign Het
Ndrg1 A G 15: 66,933,862 probably null Het
Nlrp4a A T 7: 26,450,098 N377Y probably damaging Het
Nox4 C T 7: 87,321,566 T217I probably benign Het
Olfr836 T C 9: 19,121,897 F311S possibly damaging Het
Olfr917 A T 9: 38,665,507 Y112* probably null Het
Plekhd1 T A 12: 80,721,952 F403Y possibly damaging Het
Plekhg1 T C 10: 3,963,805 S1231P Het
Plekhg3 T A 12: 76,572,065 M497K probably benign Het
Rpap1 T C 2: 119,774,188 H413R probably damaging Het
Rragd A G 4: 32,995,924 T90A probably damaging Het
Sept9 T C 11: 117,351,570 M286T probably benign Het
Shpk GACCTTAGCCAGAAGGAGCCTTAGTTCATCAA GA 11: 73,223,170 probably null Het
Slc22a2 T A 17: 12,619,870 D528E probably benign Het
Slirp G A 12: 87,447,606 R47K probably benign Het
Sncg T C 14: 34,374,517 T22A possibly damaging Het
Tnfrsf21 A G 17: 43,087,910 S636G probably damaging Het
Uhrf1bp1l A T 10: 89,790,595 T384S probably benign Het
Unc80 T G 1: 66,507,375 S535R probably damaging Het
Vmn1r149 A T 7: 22,437,953 S93T probably benign Het
Vps13d A G 4: 145,056,488 Y3957H Het
Wscd1 A G 11: 71,771,924 T264A probably benign Het
Zfp266 G A 9: 20,502,041 Q108* probably null Het
Zfp62 T A 11: 49,215,248 S55R probably benign Het
Other mutations in Wdr35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Wdr35 APN 12 9019900 missense probably benign
IGL00962:Wdr35 APN 12 9021726 splice site probably benign
IGL01094:Wdr35 APN 12 9005838 splice site probably benign
IGL01312:Wdr35 APN 12 9008655 missense probably damaging 1.00
IGL01397:Wdr35 APN 12 9008550 missense probably benign 0.04
IGL01490:Wdr35 APN 12 8977381 missense probably damaging 0.98
IGL02153:Wdr35 APN 12 9008535 missense probably null 0.04
IGL02319:Wdr35 APN 12 9027480 unclassified probably benign
IGL02548:Wdr35 APN 12 9024297 missense probably benign 0.00
IGL02941:Wdr35 APN 12 9027507 missense probably damaging 0.98
IGL03038:Wdr35 APN 12 8974185 splice site probably benign
IGL03086:Wdr35 APN 12 9008692 splice site probably null
IGL03207:Wdr35 APN 12 8989936 missense probably damaging 0.98
IGL03327:Wdr35 APN 12 8978694 splice site probably benign
R0362:Wdr35 UTSW 12 8995625 unclassified probably benign
R0464:Wdr35 UTSW 12 9027472 unclassified probably benign
R0487:Wdr35 UTSW 12 9012743 critical splice donor site probably null
R0976:Wdr35 UTSW 12 8986104 missense probably benign 0.03
R1349:Wdr35 UTSW 12 9019870 splice site probably benign
R1663:Wdr35 UTSW 12 9020000 missense probably benign 0.00
R1769:Wdr35 UTSW 12 9012728 missense probably damaging 1.00
R1779:Wdr35 UTSW 12 8985772 missense possibly damaging 0.62
R1789:Wdr35 UTSW 12 8977435 critical splice donor site probably null
R1893:Wdr35 UTSW 12 8985994 missense probably benign
R2076:Wdr35 UTSW 12 9024281 missense possibly damaging 0.88
R2228:Wdr35 UTSW 12 8974955 missense possibly damaging 0.65
R2280:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2281:Wdr35 UTSW 12 8978628 missense probably benign 0.01
R2863:Wdr35 UTSW 12 9028060 nonsense probably null
R3713:Wdr35 UTSW 12 9027648 missense possibly damaging 0.68
R3911:Wdr35 UTSW 12 8986077 missense probably benign
R3934:Wdr35 UTSW 12 9008014 missense probably damaging 1.00
R4360:Wdr35 UTSW 12 8974149 utr 5 prime probably benign
R4402:Wdr35 UTSW 12 8989981 missense probably damaging 0.98
R4473:Wdr35 UTSW 12 9015995 missense probably benign 0.00
R4656:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R4780:Wdr35 UTSW 12 9018150 missense probably benign
R5092:Wdr35 UTSW 12 8987327 missense probably damaging 1.00
R5160:Wdr35 UTSW 12 9008487 missense probably damaging 0.99
R5184:Wdr35 UTSW 12 9018142 missense probably damaging 1.00
R5346:Wdr35 UTSW 12 8978684 missense probably benign 0.00
R5435:Wdr35 UTSW 12 8989951 missense probably benign 0.01
R5472:Wdr35 UTSW 12 9016619 missense probably benign 0.00
R5682:Wdr35 UTSW 12 8981125 missense probably damaging 1.00
R5801:Wdr35 UTSW 12 9006723 missense possibly damaging 0.92
R5990:Wdr35 UTSW 12 9016511 missense probably damaging 1.00
R6196:Wdr35 UTSW 12 9027632 missense probably benign 0.05
R6531:Wdr35 UTSW 12 8978685 missense probably benign 0.00
R6746:Wdr35 UTSW 12 9003982 splice site probably null
R6816:Wdr35 UTSW 12 9027724 critical splice donor site probably null
R6863:Wdr35 UTSW 12 8990047 missense probably damaging 0.97
R7088:Wdr35 UTSW 12 8978659 missense probably benign 0.11
R7140:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7327:Wdr35 UTSW 12 8987312 missense probably benign 0.10
R7403:Wdr35 UTSW 12 9012685 missense probably damaging 0.98
R7422:Wdr35 UTSW 12 9004105 missense probably benign 0.00
R7438:Wdr35 UTSW 12 9022785 missense probably damaging 0.98
R7466:Wdr35 UTSW 12 9005773 missense probably benign
R7491:Wdr35 UTSW 12 8986000 missense probably benign 0.00
R7599:Wdr35 UTSW 12 9024886 missense probably benign 0.01
R7620:Wdr35 UTSW 12 9016042 missense probably benign 0.04
R7857:Wdr35 UTSW 12 9008113 critical splice donor site probably null
R8289:Wdr35 UTSW 12 9008020 missense probably benign 0.00
R8302:Wdr35 UTSW 12 9028110 missense probably benign 0.09
R8433:Wdr35 UTSW 12 9008495 missense probably damaging 1.00
R8479:Wdr35 UTSW 12 8985985 missense probably benign 0.04
R8498:Wdr35 UTSW 12 9008626 missense probably damaging 0.97
R8721:Wdr35 UTSW 12 9025044 critical splice donor site probably null
R9368:Wdr35 UTSW 12 9021826 missense probably benign 0.00
R9573:Wdr35 UTSW 12 9028014 missense probably benign 0.00
R9596:Wdr35 UTSW 12 8986092 missense probably benign 0.08
R9773:Wdr35 UTSW 12 8989990 missense probably benign 0.03
X0066:Wdr35 UTSW 12 8990029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCCAAATAATGCGGCATGAG -3'
(R):5'- TTCCCTGATTACGGCTGTG -3'

Sequencing Primer
(F):5'- TGCGGCATGAGAATGACC -3'
(R):5'- GGCTGTGCCTGATGGAAATG -3'
Posted On 2022-02-07