Incidental Mutation 'R9220:Afg3l2'
ID 699433
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene Name AFG3-like AAA ATPase 2
Synonyms 2310036I02Rik, Emv66, par
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9220 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 67404767-67449166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 67429196 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 270 (I270L)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
AlphaFold Q8JZQ2
Predicted Effect probably benign
Transcript: ENSMUST00000025408
AA Change: I270L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: I270L

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,520 I103V probably benign Het
AF529169 T A 9: 89,602,345 D333V probably damaging Het
Akap6 A T 12: 53,140,449 I1549F possibly damaging Het
Ank2 T C 3: 126,943,437 T2933A unknown Het
Atp1a3 C A 7: 24,997,200 E309* probably null Het
B4galt2 T C 4: 117,877,202 Y250C probably damaging Het
Bcl2l13 C A 6: 120,870,774 T129K possibly damaging Het
Clp1 A T 2: 84,723,732 H364Q probably damaging Het
Ddx27 T C 2: 167,029,513 V510A probably benign Het
Dicer1 A G 12: 104,713,156 C521R probably damaging Het
Dnah10 A T 5: 124,794,373 I2486F probably benign Het
Eml1 C A 12: 108,514,443 C389* probably null Het
Fabp6 C T 11: 43,598,745 G23D probably benign Het
Fam3b A T 16: 97,500,911 S38T probably benign Het
Fsd1l A T 4: 53,679,799 K166* probably null Het
Galc A G 12: 98,254,264 S115P probably damaging Het
Gm498 G T 7: 143,881,165 probably null Het
Gpn1 G A 5: 31,507,540 A303T probably benign Het
Grid2 A T 6: 63,908,904 S95C probably damaging Het
Helz T A 11: 107,670,047 S1312T probably benign Het
Matn2 T C 15: 34,410,179 F506L possibly damaging Het
Mcemp1 A G 8: 3,667,512 S148G probably benign Het
Ndrg1 A G 15: 66,933,862 probably null Het
Nlrp4a A T 7: 26,450,098 N377Y probably damaging Het
Nox4 C T 7: 87,321,566 T217I probably benign Het
Olfr836 T C 9: 19,121,897 F311S possibly damaging Het
Olfr917 A T 9: 38,665,507 Y112* probably null Het
Plekhd1 T A 12: 80,721,952 F403Y possibly damaging Het
Plekhg1 T C 10: 3,963,805 S1231P Het
Plekhg3 T A 12: 76,572,065 M497K probably benign Het
Rpap1 T C 2: 119,774,188 H413R probably damaging Het
Rragd A G 4: 32,995,924 T90A probably damaging Het
Sept9 T C 11: 117,351,570 M286T probably benign Het
Shpk GACCTTAGCCAGAAGGAGCCTTAGTTCATCAA GA 11: 73,223,170 probably null Het
Slc22a2 T A 17: 12,619,870 D528E probably benign Het
Slirp G A 12: 87,447,606 R47K probably benign Het
Sncg T C 14: 34,374,517 T22A possibly damaging Het
Tnfrsf21 A G 17: 43,087,910 S636G probably damaging Het
Uhrf1bp1l A T 10: 89,790,595 T384S probably benign Het
Unc80 T G 1: 66,507,375 S535R probably damaging Het
Vmn1r149 A T 7: 22,437,953 S93T probably benign Het
Vps13d A G 4: 145,056,488 Y3957H Het
Wdr35 T A 12: 8,986,000 V257E possibly damaging Het
Wscd1 A G 11: 71,771,924 T264A probably benign Het
Zfp266 G A 9: 20,502,041 Q108* probably null Het
Zfp62 T A 11: 49,215,248 S55R probably benign Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
R8479:Afg3l2 UTSW 18 67448916 missense probably benign 0.05
R8531:Afg3l2 UTSW 18 67407369 missense probably damaging 0.99
R9017:Afg3l2 UTSW 18 67409480 missense possibly damaging 0.81
R9222:Afg3l2 UTSW 18 67434187 missense probably benign 0.05
R9371:Afg3l2 UTSW 18 67434192 missense possibly damaging 0.84
R9381:Afg3l2 UTSW 18 67442381 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TGCTCCTAGGTCTTGATATTGC -3'
(R):5'- AAGATTCTCCTGTGCCTCACG -3'

Sequencing Primer
(F):5'- GCTTTGGGTTTTTCAAGAAATTCACG -3'
(R):5'- TCCTGTGCCTCACGTAAATTACAAG -3'
Posted On 2022-02-07