Incidental Mutation 'R9221:Rp1'
ID 699434
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Name retinitis pigmentosa 1 (human)
Synonyms Dcdc3, Orp1, mG145, Rp1h, oxygen-regulated protein 1
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R9221 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 4185896-4479508 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4315266 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 502 (F502S)
Ref Sequence ENSEMBL: ENSMUSP00000146439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208660]
AlphaFold P56716
Predicted Effect unknown
Transcript: ENSMUST00000208660
AA Change: F502S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,921,828 (GRCm39) D1128G probably damaging Het
Acsm3 A T 7: 119,368,131 (GRCm39) R116* probably null Het
Acte1 G T 7: 143,434,902 (GRCm39) probably null Het
Ahnak T A 19: 8,989,943 (GRCm39) D3742E probably damaging Het
Arhgef17 A G 7: 100,528,818 (GRCm39) S598P possibly damaging Het
Asxl2 T C 12: 3,552,310 (GRCm39) F1351L probably damaging Het
Atg7 C T 6: 114,672,588 (GRCm39) T267I possibly damaging Het
Bace2 A G 16: 97,209,692 (GRCm39) K202R probably benign Het
Bccip G T 7: 133,311,249 (GRCm39) V55L probably benign Het
Bpifa1 T A 2: 153,988,052 (GRCm39) H198Q possibly damaging Het
Btbd7 A G 12: 102,777,430 (GRCm39) Y466H probably damaging Het
Cdc45 A C 16: 18,605,521 (GRCm39) S480A probably benign Het
Cenpe T C 3: 134,935,839 (GRCm39) Y425H possibly damaging Het
Cep76 A C 18: 67,767,977 (GRCm39) M185R probably damaging Het
Chd5 G T 4: 152,456,122 (GRCm39) M930I probably damaging Het
Clstn2 G T 9: 97,343,395 (GRCm39) T684K probably benign Het
Col4a2 A G 8: 11,491,943 (GRCm39) N1270S possibly damaging Het
Crxos A G 7: 15,636,850 (GRCm39) H141R probably benign Het
Dcc A G 18: 71,553,433 (GRCm39) I741T possibly damaging Het
Ddx20 A T 3: 105,587,685 (GRCm39) C430* probably null Het
Dgki G A 6: 37,273,615 (GRCm39) T12M probably benign Het
Dock6 T C 9: 21,721,153 (GRCm39) N1676S possibly damaging Het
Exosc6 G A 8: 111,783,028 (GRCm39) R9H probably damaging Het
Fstl5 A G 3: 76,569,114 (GRCm39) Q589R probably damaging Het
Gm4846 T A 1: 166,324,959 (GRCm39) Y44F probably benign Het
Gpr15lg A G 14: 36,829,352 (GRCm39) S44P probably damaging Het
Gtf3c2 A C 5: 31,326,401 (GRCm39) I370R probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspg2 A G 4: 137,287,726 (GRCm39) M3696V possibly damaging Het
Itga1 A T 13: 115,166,695 (GRCm39) C167* probably null Het
Khdc4 T C 3: 88,593,853 (GRCm39) S81P probably benign Het
Kpna2 A G 11: 106,880,158 (GRCm39) S497P probably damaging Het
Krt77 T A 15: 101,774,064 (GRCm39) T197S probably damaging Het
Krtap6-5 T C 16: 88,844,655 (GRCm39) Y26C unknown Het
Lhfpl5 A T 17: 28,799,133 (GRCm39) D214V possibly damaging Het
Lrrtm1 A G 6: 77,221,596 (GRCm39) E351G probably damaging Het
Mphosph9 A G 5: 124,403,427 (GRCm39) V867A probably benign Het
Mtcl1 T A 17: 66,650,879 (GRCm39) M1529L probably benign Het
Mthfr A T 4: 148,132,626 (GRCm39) Q268L probably damaging Het
Myo1d A T 11: 80,565,744 (GRCm39) N360K probably damaging Het
Nbea AC A 3: 55,998,393 (GRCm39) probably null Het
Or1e33 A T 11: 73,738,108 (GRCm39) V281E probably damaging Het
Or4p8 T C 2: 88,727,255 (GRCm39) S229G probably benign Het
Or5an1b A T 19: 12,299,336 (GRCm39) M285K probably damaging Het
Or5m11 T A 2: 85,782,185 (GRCm39) Y259* probably null Het
P2rx5 A T 11: 73,062,655 (GRCm39) T455S probably damaging Het
Palld A T 8: 61,969,591 (GRCm39) F1244L unknown Het
Pbld1 A G 10: 62,907,829 (GRCm39) T125A Het
Pde3b G A 7: 114,014,697 (GRCm39) probably benign Het
Pfkm T C 15: 98,019,188 (GRCm39) S180P probably damaging Het
Pla2g4d T A 2: 120,100,453 (GRCm39) R626S possibly damaging Het
Postn A G 3: 54,282,515 (GRCm39) E492G possibly damaging Het
Prph2 A G 17: 47,230,818 (GRCm39) D237G probably damaging Het
Psmd4 T C 3: 94,942,604 (GRCm39) H105R probably damaging Het
Pygl T C 12: 70,242,401 (GRCm39) N685S probably damaging Het
Sik1 T C 17: 32,066,167 (GRCm39) I607V probably benign Het
Slc26a3 T A 12: 31,513,470 (GRCm39) I464N possibly damaging Het
Slc38a9 A G 13: 112,825,910 (GRCm39) N116S probably damaging Het
Sorcs2 C A 5: 36,181,910 (GRCm39) probably null Het
Spink5 T C 18: 44,119,367 (GRCm39) L226P probably damaging Het
Tab1 G A 15: 80,034,754 (GRCm39) V180I probably benign Het
Tacc2 T G 7: 130,226,058 (GRCm39) S914R probably damaging Het
Tacc2 C T 7: 130,226,209 (GRCm39) R965C probably benign Het
Tlr9 A G 9: 106,101,972 (GRCm39) D421G probably damaging Het
Tmem181a T C 17: 6,307,265 (GRCm39) L16P probably damaging Het
Trim58 A T 11: 58,542,075 (GRCm39) H345L probably damaging Het
Ttc13 G A 8: 125,400,290 (GRCm39) R688C probably benign Het
Ube2o C A 11: 116,433,664 (GRCm39) V685L probably damaging Het
Uso1 A G 5: 92,335,173 (GRCm39) H511R probably benign Het
Vmn2r5 A T 3: 64,411,721 (GRCm39) Y282* probably null Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4,416,969 (GRCm39) missense probably damaging 0.98
IGL00593:Rp1 APN 1 4,415,626 (GRCm39) missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4,422,435 (GRCm39) missense probably damaging 1.00
IGL01070:Rp1 APN 1 4,415,461 (GRCm39) missense probably damaging 1.00
IGL01531:Rp1 APN 1 4,419,168 (GRCm39) missense probably benign 0.00
IGL01668:Rp1 APN 1 4,415,941 (GRCm39) missense probably damaging 1.00
IGL01907:Rp1 APN 1 4,418,730 (GRCm39) missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4,422,745 (GRCm39) missense probably damaging 1.00
IGL02071:Rp1 APN 1 4,415,533 (GRCm39) missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4,417,608 (GRCm39) missense probably damaging 0.99
IGL02244:Rp1 APN 1 4,419,003 (GRCm39) missense probably benign 0.00
IGL02381:Rp1 APN 1 4,422,613 (GRCm39) missense probably benign 0.01
IGL02499:Rp1 APN 1 4,419,271 (GRCm39) missense probably benign 0.17
IGL02619:Rp1 APN 1 4,418,673 (GRCm39) missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4,419,936 (GRCm39) missense probably benign 0.03
IGL02861:Rp1 APN 1 4,416,375 (GRCm39) nonsense probably null
IGL03288:Rp1 APN 1 4,419,747 (GRCm39) missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4,420,264 (GRCm39) missense probably damaging 1.00
IGL03303:Rp1 APN 1 4,415,040 (GRCm39) missense probably damaging 1.00
R0041:Rp1 UTSW 1 4,414,851 (GRCm39) missense probably benign 0.36
R0111:Rp1 UTSW 1 4,414,983 (GRCm39) missense probably damaging 1.00
R0363:Rp1 UTSW 1 4,417,941 (GRCm39) missense probably damaging 1.00
R0440:Rp1 UTSW 1 4,415,863 (GRCm39) missense probably damaging 1.00
R0442:Rp1 UTSW 1 4,416,970 (GRCm39) missense probably benign 0.09
R0528:Rp1 UTSW 1 4,415,088 (GRCm39) missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4,418,060 (GRCm39) missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4,416,721 (GRCm39) missense probably benign 0.00
R0856:Rp1 UTSW 1 4,414,878 (GRCm39) missense probably benign 0.05
R0908:Rp1 UTSW 1 4,414,878 (GRCm39) missense probably benign 0.05
R0968:Rp1 UTSW 1 4,415,575 (GRCm39) missense probably benign 0.00
R1099:Rp1 UTSW 1 4,422,513 (GRCm39) missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4,415,185 (GRCm39) missense probably benign 0.03
R1301:Rp1 UTSW 1 4,416,159 (GRCm39) missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4,418,193 (GRCm39) missense probably benign 0.01
R1403:Rp1 UTSW 1 4,416,520 (GRCm39) missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4,416,520 (GRCm39) missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4,422,144 (GRCm39) missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4,422,144 (GRCm39) missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4,417,619 (GRCm39) missense probably damaging 1.00
R1509:Rp1 UTSW 1 4,418,760 (GRCm39) missense probably benign 0.20
R1509:Rp1 UTSW 1 4,417,917 (GRCm39) missense probably damaging 0.98
R1538:Rp1 UTSW 1 4,415,899 (GRCm39) missense probably damaging 1.00
R1609:Rp1 UTSW 1 4,419,424 (GRCm39) missense probably damaging 1.00
R1666:Rp1 UTSW 1 4,420,086 (GRCm39) missense probably damaging 1.00
R1703:Rp1 UTSW 1 4,415,392 (GRCm39) missense probably damaging 1.00
R1782:Rp1 UTSW 1 4,419,312 (GRCm39) missense probably benign 0.00
R1799:Rp1 UTSW 1 4,419,055 (GRCm39) missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4,417,455 (GRCm39) missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4,418,943 (GRCm39) missense probably damaging 0.99
R1919:Rp1 UTSW 1 4,422,894 (GRCm39) missense probably damaging 0.99
R2087:Rp1 UTSW 1 4,418,575 (GRCm39) missense probably damaging 1.00
R2211:Rp1 UTSW 1 4,418,362 (GRCm39) missense probably damaging 0.96
R2278:Rp1 UTSW 1 4,418,250 (GRCm39) missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4,416,182 (GRCm39) nonsense probably null
R2316:Rp1 UTSW 1 4,415,863 (GRCm39) missense probably damaging 1.00
R2346:Rp1 UTSW 1 4,418,236 (GRCm39) missense probably damaging 1.00
R2878:Rp1 UTSW 1 4,418,362 (GRCm39) missense probably damaging 1.00
R3023:Rp1 UTSW 1 4,422,898 (GRCm39) missense probably damaging 1.00
R3025:Rp1 UTSW 1 4,422,898 (GRCm39) missense probably damaging 1.00
R3716:Rp1 UTSW 1 4,419,988 (GRCm39) missense probably benign 0.38
R3814:Rp1 UTSW 1 4,419,931 (GRCm39) missense probably benign
R3929:Rp1 UTSW 1 4,422,868 (GRCm39) missense probably damaging 1.00
R4064:Rp1 UTSW 1 4,415,623 (GRCm39) missense probably benign 0.08
R4426:Rp1 UTSW 1 4,418,147 (GRCm39) missense probably benign 0.13
R4557:Rp1 UTSW 1 4,414,886 (GRCm39) missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4,416,101 (GRCm39) missense probably damaging 0.96
R4845:Rp1 UTSW 1 4,419,451 (GRCm39) missense probably benign 0.02
R4850:Rp1 UTSW 1 4,418,898 (GRCm39) missense probably damaging 1.00
R4857:Rp1 UTSW 1 4,422,540 (GRCm39) missense probably damaging 1.00
R4857:Rp1 UTSW 1 4,422,539 (GRCm39) missense probably damaging 0.99
R5159:Rp1 UTSW 1 4,416,426 (GRCm39) missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4,418,256 (GRCm39) missense probably benign 0.01
R5327:Rp1 UTSW 1 4,419,583 (GRCm39) splice site probably null
R5352:Rp1 UTSW 1 4,417,321 (GRCm39) missense probably benign 0.00
R5504:Rp1 UTSW 1 4,420,113 (GRCm39) missense probably damaging 1.00
R5527:Rp1 UTSW 1 4,416,616 (GRCm39) missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4,416,055 (GRCm39) missense probably benign 0.42
R5569:Rp1 UTSW 1 4,415,460 (GRCm39) missense probably damaging 1.00
R5622:Rp1 UTSW 1 4,418,060 (GRCm39) missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4,418,685 (GRCm39) missense probably benign 0.05
R5992:Rp1 UTSW 1 4,218,926 (GRCm39) missense unknown
R6004:Rp1 UTSW 1 4,267,808 (GRCm39) missense unknown
R6018:Rp1 UTSW 1 4,423,059 (GRCm39) missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4,415,602 (GRCm39) missense probably benign 0.02
R6127:Rp1 UTSW 1 4,419,534 (GRCm39) missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4,420,092 (GRCm39) missense probably damaging 1.00
R6301:Rp1 UTSW 1 4,417,477 (GRCm39) missense probably benign 0.04
R6317:Rp1 UTSW 1 4,112,212 (GRCm39) missense unknown
R6405:Rp1 UTSW 1 4,415,994 (GRCm39) missense probably damaging 1.00
R6445:Rp1 UTSW 1 4,296,840 (GRCm39) missense unknown
R6466:Rp1 UTSW 1 4,418,109 (GRCm39) missense probably benign 0.01
R6501:Rp1 UTSW 1 4,381,503 (GRCm39) intron probably benign
R6547:Rp1 UTSW 1 4,240,528 (GRCm39) missense unknown
R6604:Rp1 UTSW 1 4,089,351 (GRCm39) missense unknown
R6700:Rp1 UTSW 1 4,420,119 (GRCm39) missense probably damaging 1.00
R6706:Rp1 UTSW 1 4,212,887 (GRCm39) missense unknown
R6831:Rp1 UTSW 1 4,420,087 (GRCm39) splice site probably null
R6918:Rp1 UTSW 1 4,069,831 (GRCm39) missense unknown
R6973:Rp1 UTSW 1 4,422,217 (GRCm39) nonsense probably null
R6981:Rp1 UTSW 1 4,415,878 (GRCm39) missense probably benign 0.06
R7009:Rp1 UTSW 1 4,112,291 (GRCm39) missense unknown
R7078:Rp1 UTSW 1 4,277,014 (GRCm39) missense unknown
R7112:Rp1 UTSW 1 4,419,241 (GRCm39) missense probably benign 0.43
R7135:Rp1 UTSW 1 4,418,391 (GRCm39) missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4,420,140 (GRCm39) missense probably damaging 0.99
R7199:Rp1 UTSW 1 4,417,513 (GRCm39) missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4,298,824 (GRCm39) missense unknown
R7367:Rp1 UTSW 1 4,418,221 (GRCm39) missense probably benign 0.42
R7484:Rp1 UTSW 1 4,415,704 (GRCm39) missense probably benign 0.10
R7500:Rp1 UTSW 1 4,381,501 (GRCm39) missense unknown
R7569:Rp1 UTSW 1 4,355,063 (GRCm39) missense unknown
R7642:Rp1 UTSW 1 4,218,054 (GRCm39) missense unknown
R7693:Rp1 UTSW 1 4,417,626 (GRCm39) missense probably damaging 1.00
R7742:Rp1 UTSW 1 4,240,457 (GRCm39) missense unknown
R7759:Rp1 UTSW 1 4,415,107 (GRCm39) missense probably benign
R7784:Rp1 UTSW 1 4,212,881 (GRCm39) missense unknown
R7816:Rp1 UTSW 1 4,417,926 (GRCm39) missense probably damaging 0.98
R7866:Rp1 UTSW 1 4,417,924 (GRCm39) missense probably benign 0.02
R8215:Rp1 UTSW 1 4,315,318 (GRCm39) missense unknown
R8281:Rp1 UTSW 1 4,418,139 (GRCm39) missense probably damaging 1.00
R8294:Rp1 UTSW 1 4,416,220 (GRCm39) missense probably benign 0.09
R8309:Rp1 UTSW 1 4,417,312 (GRCm39) missense probably benign 0.00
R8311:Rp1 UTSW 1 4,418,572 (GRCm39) missense probably benign 0.11
R8500:Rp1 UTSW 1 4,416,813 (GRCm39) missense possibly damaging 0.91
R8559:Rp1 UTSW 1 4,419,784 (GRCm39) missense probably damaging 1.00
R8672:Rp1 UTSW 1 4,419,007 (GRCm39) missense possibly damaging 0.55
R8688:Rp1 UTSW 1 4,416,628 (GRCm39) missense probably benign 0.01
R8792:Rp1 UTSW 1 4,095,091 (GRCm39) missense unknown
R8859:Rp1 UTSW 1 4,420,183 (GRCm39) missense probably benign 0.07
R8945:Rp1 UTSW 1 4,419,817 (GRCm39) missense probably benign 0.42
R8959:Rp1 UTSW 1 4,419,650 (GRCm39) intron probably benign
R8979:Rp1 UTSW 1 4,218,937 (GRCm39) missense unknown
R9126:Rp1 UTSW 1 4,417,136 (GRCm39) missense probably damaging 0.99
R9156:Rp1 UTSW 1 4,234,161 (GRCm39) missense unknown
R9160:Rp1 UTSW 1 4,416,720 (GRCm39) missense probably benign 0.00
R9263:Rp1 UTSW 1 4,419,160 (GRCm39) missense probably benign 0.02
R9263:Rp1 UTSW 1 4,418,675 (GRCm39) missense probably benign 0.25
R9302:Rp1 UTSW 1 4,416,789 (GRCm39) missense probably damaging 1.00
R9318:Rp1 UTSW 1 4,418,488 (GRCm39) missense probably benign 0.09
R9414:Rp1 UTSW 1 4,313,841 (GRCm39) missense unknown
R9474:Rp1 UTSW 1 4,162,838 (GRCm39) critical splice donor site probably null
R9478:Rp1 UTSW 1 4,417,545 (GRCm39) missense probably benign 0.06
R9529:Rp1 UTSW 1 4,416,447 (GRCm39) missense probably benign
R9572:Rp1 UTSW 1 4,418,662 (GRCm39) missense probably benign
R9673:Rp1 UTSW 1 4,337,792 (GRCm39) missense unknown
R9709:Rp1 UTSW 1 4,112,255 (GRCm39) missense unknown
R9716:Rp1 UTSW 1 4,212,833 (GRCm39) critical splice donor site probably null
RF003:Rp1 UTSW 1 4,414,917 (GRCm39) missense probably damaging 0.99
V1662:Rp1 UTSW 1 4,419,783 (GRCm39) missense probably damaging 1.00
X0012:Rp1 UTSW 1 4,417,918 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGCCTGGTTAAATCTAGTGGC -3'
(R):5'- TGAAGATGATAGGTCTAGAATTGCG -3'

Sequencing Primer
(F):5'- CAAATGGGATGGCAACCTGTGTG -3'
(R):5'- GTCATTATCTTCTGTTACAAGTAGA -3'
Posted On 2022-02-07