Incidental Mutation 'R9221:Rp1'
ID 699434
Institutional Source Beutler Lab
Gene Symbol Rp1
Ensembl Gene ENSMUSG00000025900
Gene Name retinitis pigmentosa 1 (human)
Synonyms Dcdc3, mG145, Orp1, oxygen-regulated protein 1, Rp1h
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R9221 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 3999557-4409241 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4245043 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 502 (F502S)
Ref Sequence ENSEMBL: ENSMUSP00000146439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208660]
AlphaFold P56716
Predicted Effect unknown
Transcript: ENSMUST00000208660
AA Change: F502S
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. The encoded protein is a photoreceptor microtubule-associated protein and is required for correct stacking of outer segment disc. This protein and the RP1L1 protein, another retinal-specific protein, play essential and synergistic roles in affecting photosensitivity and outer segment morphogenesis of rod photoreceptors. Because of its response to in vivo retinal oxygen levels, this protein was initially named ORP1 (oxygen-regulated protein-1). This protein was subsequently designated RP1 (retinitis pigmentosa 1) when it was found that mutations in this gene cause autosomal dominant retinitis pigmentosa. Mutations in this gene also cause autosomal recessive retinitis pigmentosa. Two transcript variants encoding distinct isoforms are resulted from alternative promoters and alternative splicing. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene experience progressive degeneration in photoreceptors but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610528A11Rik A G 14: 37,107,395 S44P probably damaging Het
2810403A07Rik T C 3: 88,686,546 S81P probably benign Het
Abca4 A G 3: 122,128,179 D1128G probably damaging Het
Acsm3 A T 7: 119,768,908 R116* probably null Het
Ahnak T A 19: 9,012,579 D3742E probably damaging Het
Arhgef17 A G 7: 100,879,611 S598P possibly damaging Het
Asxl2 T C 12: 3,502,310 F1351L probably damaging Het
Atg7 C T 6: 114,695,627 T267I possibly damaging Het
Bace2 A G 16: 97,408,492 K202R probably benign Het
Bccip G T 7: 133,709,520 V55L probably benign Het
Bpifa1 T A 2: 154,146,132 H198Q possibly damaging Het
Btbd7 A G 12: 102,811,171 Y466H probably damaging Het
Cdc45 A C 16: 18,786,771 S480A probably benign Het
Cenpe T C 3: 135,230,078 Y425H possibly damaging Het
Cep76 A C 18: 67,634,907 M185R probably damaging Het
Chd5 G T 4: 152,371,665 M930I probably damaging Het
Clstn2 G T 9: 97,461,342 T684K probably benign Het
Col4a2 A G 8: 11,441,943 N1270S possibly damaging Het
Crxos A G 7: 15,902,925 H141R probably benign Het
Dcc A G 18: 71,420,362 I741T possibly damaging Het
Ddx20 A T 3: 105,680,369 C430* probably null Het
Dgki G A 6: 37,296,680 T12M probably benign Het
Dock6 T C 9: 21,809,857 N1676S possibly damaging Het
Exosc6 G A 8: 111,056,396 R9H probably damaging Het
Fstl5 A G 3: 76,661,807 Q589R probably damaging Het
Gm4846 T A 1: 166,497,390 Y44F probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gtf3c2 A C 5: 31,169,057 I370R probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hspg2 A G 4: 137,560,415 M3696V possibly damaging Het
Itga1 A T 13: 115,030,159 C167* probably null Het
Kpna2 A G 11: 106,989,332 S497P probably damaging Het
Krt77 T A 15: 101,865,629 T197S probably damaging Het
Krtap6-5 T C 16: 89,047,767 Y26C unknown Het
Lhfpl5 A T 17: 28,580,159 D214V possibly damaging Het
Lrrtm1 A G 6: 77,244,613 E351G probably damaging Het
Mphosph9 A G 5: 124,265,364 V867A probably benign Het
Mtcl1 T A 17: 66,343,884 M1529L probably benign Het
Mthfr A T 4: 148,048,169 Q268L probably damaging Het
Myo1d A T 11: 80,674,918 N360K probably damaging Het
Nbea AC A 3: 56,090,972 probably null Het
Olfr1028 T A 2: 85,951,841 Y259* probably null Het
Olfr1208 T C 2: 88,896,911 S229G probably benign Het
Olfr1437 A T 19: 12,321,972 M285K probably damaging Het
Olfr393 A T 11: 73,847,282 V281E probably damaging Het
P2rx5 A T 11: 73,171,829 T455S probably damaging Het
Palld A T 8: 61,516,557 F1244L unknown Het
Pbld1 A G 10: 63,072,050 T125A Het
Pde3b G A 7: 114,415,462 probably benign Het
Pfkm T C 15: 98,121,307 S180P probably damaging Het
Pla2g4d T A 2: 120,269,972 R626S possibly damaging Het
Postn A G 3: 54,375,094 E492G possibly damaging Het
Prph2 A G 17: 46,919,892 D237G probably damaging Het
Psmd4 T C 3: 95,035,293 H105R probably damaging Het
Pygl T C 12: 70,195,627 N685S probably damaging Het
Sik1 T C 17: 31,847,193 I607V probably benign Het
Slc26a3 T A 12: 31,463,471 I464N possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Sorcs2 C A 5: 36,024,566 probably null Het
Spink5 T C 18: 43,986,300 L226P probably damaging Het
Tab1 G A 15: 80,150,553 V180I probably benign Het
Tacc2 T G 7: 130,624,328 S914R probably damaging Het
Tacc2 C T 7: 130,624,479 R965C probably benign Het
Tlr9 A G 9: 106,224,773 D421G probably damaging Het
Tmem181a T C 17: 6,256,990 L16P probably damaging Het
Trim58 A T 11: 58,651,249 H345L probably damaging Het
Ttc13 G A 8: 124,673,551 R688C probably benign Het
Ube2o C A 11: 116,542,838 V685L probably damaging Het
Uso1 A G 5: 92,187,314 H511R probably benign Het
Vmn2r5 A T 3: 64,504,300 Y282* probably null Het
Other mutations in Rp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rp1 APN 1 4346746 missense probably damaging 0.98
IGL00593:Rp1 APN 1 4345403 missense possibly damaging 0.70
IGL00956:Rp1 APN 1 4352212 missense probably damaging 1.00
IGL01070:Rp1 APN 1 4345238 missense probably damaging 1.00
IGL01531:Rp1 APN 1 4348945 missense probably benign 0.00
IGL01668:Rp1 APN 1 4345718 missense probably damaging 1.00
IGL01907:Rp1 APN 1 4348507 missense possibly damaging 0.56
IGL02055:Rp1 APN 1 4352522 missense probably damaging 1.00
IGL02071:Rp1 APN 1 4345310 missense possibly damaging 0.46
IGL02128:Rp1 APN 1 4347385 missense probably damaging 0.99
IGL02244:Rp1 APN 1 4348780 missense probably benign 0.00
IGL02381:Rp1 APN 1 4352390 missense probably benign 0.01
IGL02499:Rp1 APN 1 4349048 missense probably benign 0.17
IGL02619:Rp1 APN 1 4348450 missense possibly damaging 0.73
IGL02832:Rp1 APN 1 4349713 missense probably benign 0.03
IGL02861:Rp1 APN 1 4346152 nonsense probably null
IGL03288:Rp1 APN 1 4349524 missense possibly damaging 0.88
IGL03290:Rp1 APN 1 4350041 missense probably damaging 1.00
IGL03303:Rp1 APN 1 4344817 missense probably damaging 1.00
R0041:Rp1 UTSW 1 4344628 missense probably benign 0.36
R0111:Rp1 UTSW 1 4344760 missense probably damaging 1.00
R0363:Rp1 UTSW 1 4347718 missense probably damaging 1.00
R0440:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R0442:Rp1 UTSW 1 4346747 missense probably benign 0.09
R0528:Rp1 UTSW 1 4344865 missense possibly damaging 0.82
R0586:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R0639:Rp1 UTSW 1 4346498 missense probably benign 0.00
R0856:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0908:Rp1 UTSW 1 4344655 missense probably benign 0.05
R0968:Rp1 UTSW 1 4345352 missense probably benign 0.00
R1099:Rp1 UTSW 1 4352290 missense possibly damaging 0.45
R1242:Rp1 UTSW 1 4344962 missense probably benign 0.03
R1301:Rp1 UTSW 1 4345936 missense possibly damaging 0.56
R1327:Rp1 UTSW 1 4347970 missense probably benign 0.01
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1403:Rp1 UTSW 1 4346297 missense possibly damaging 0.73
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1406:Rp1 UTSW 1 4351921 missense possibly damaging 0.88
R1440:Rp1 UTSW 1 4347396 missense probably damaging 1.00
R1509:Rp1 UTSW 1 4347694 missense probably damaging 0.98
R1509:Rp1 UTSW 1 4348537 missense probably benign 0.20
R1538:Rp1 UTSW 1 4345676 missense probably damaging 1.00
R1609:Rp1 UTSW 1 4349201 missense probably damaging 1.00
R1666:Rp1 UTSW 1 4349863 missense probably damaging 1.00
R1703:Rp1 UTSW 1 4345169 missense probably damaging 1.00
R1782:Rp1 UTSW 1 4349089 missense probably benign 0.00
R1799:Rp1 UTSW 1 4348832 missense possibly damaging 0.94
R1848:Rp1 UTSW 1 4347232 missense possibly damaging 0.76
R1908:Rp1 UTSW 1 4348720 missense probably damaging 0.99
R1919:Rp1 UTSW 1 4352671 missense probably damaging 0.99
R2087:Rp1 UTSW 1 4348352 missense probably damaging 1.00
R2211:Rp1 UTSW 1 4348139 missense probably damaging 0.96
R2278:Rp1 UTSW 1 4348027 missense possibly damaging 0.51
R2287:Rp1 UTSW 1 4345959 nonsense probably null
R2316:Rp1 UTSW 1 4345640 missense probably damaging 1.00
R2346:Rp1 UTSW 1 4348013 missense probably damaging 1.00
R2878:Rp1 UTSW 1 4348139 missense probably damaging 1.00
R3023:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3025:Rp1 UTSW 1 4352675 missense probably damaging 1.00
R3716:Rp1 UTSW 1 4349765 missense probably benign 0.38
R3814:Rp1 UTSW 1 4349708 missense probably benign
R3929:Rp1 UTSW 1 4352645 missense probably damaging 1.00
R4064:Rp1 UTSW 1 4345400 missense probably benign 0.08
R4426:Rp1 UTSW 1 4347924 missense probably benign 0.13
R4557:Rp1 UTSW 1 4344663 missense possibly damaging 0.61
R4764:Rp1 UTSW 1 4345878 missense probably damaging 0.96
R4845:Rp1 UTSW 1 4349228 missense probably benign 0.02
R4850:Rp1 UTSW 1 4348675 missense probably damaging 1.00
R4857:Rp1 UTSW 1 4352316 missense probably damaging 0.99
R4857:Rp1 UTSW 1 4352317 missense probably damaging 1.00
R5159:Rp1 UTSW 1 4346203 missense possibly damaging 0.73
R5226:Rp1 UTSW 1 4348033 missense probably benign 0.01
R5327:Rp1 UTSW 1 4349360 splice site probably null
R5352:Rp1 UTSW 1 4347098 missense probably benign 0.00
R5504:Rp1 UTSW 1 4349890 missense probably damaging 1.00
R5527:Rp1 UTSW 1 4346393 missense possibly damaging 0.75
R5529:Rp1 UTSW 1 4345832 missense probably benign 0.42
R5569:Rp1 UTSW 1 4345237 missense probably damaging 1.00
R5622:Rp1 UTSW 1 4347837 missense possibly damaging 0.76
R5970:Rp1 UTSW 1 4348462 missense probably benign 0.05
R5992:Rp1 UTSW 1 4148703 missense unknown
R6004:Rp1 UTSW 1 4197585 missense unknown
R6018:Rp1 UTSW 1 4352836 missense possibly damaging 0.83
R6074:Rp1 UTSW 1 4345379 missense probably benign 0.02
R6127:Rp1 UTSW 1 4349311 missense possibly damaging 0.80
R6187:Rp1 UTSW 1 4349869 missense probably damaging 1.00
R6301:Rp1 UTSW 1 4347254 missense probably benign 0.04
R6317:Rp1 UTSW 1 4041989 missense unknown
R6405:Rp1 UTSW 1 4345771 missense probably damaging 1.00
R6445:Rp1 UTSW 1 4226617 missense unknown
R6466:Rp1 UTSW 1 4347886 missense probably benign 0.01
R6501:Rp1 UTSW 1 4311280 intron probably benign
R6547:Rp1 UTSW 1 4170305 missense unknown
R6604:Rp1 UTSW 1 4019128 missense unknown
R6700:Rp1 UTSW 1 4349896 missense probably damaging 1.00
R6706:Rp1 UTSW 1 4142664 missense unknown
R6831:Rp1 UTSW 1 4349864 splice site probably null
R6918:Rp1 UTSW 1 3999608 missense unknown
R6973:Rp1 UTSW 1 4351994 nonsense probably null
R6981:Rp1 UTSW 1 4345655 missense probably benign 0.06
R7009:Rp1 UTSW 1 4042068 missense unknown
R7078:Rp1 UTSW 1 4206791 missense unknown
R7112:Rp1 UTSW 1 4349018 missense probably benign 0.43
R7135:Rp1 UTSW 1 4348168 missense possibly damaging 0.83
R7165:Rp1 UTSW 1 4349917 missense probably damaging 0.99
R7199:Rp1 UTSW 1 4347290 missense possibly damaging 0.73
R7232:Rp1 UTSW 1 4228601 missense unknown
R7367:Rp1 UTSW 1 4347998 missense probably benign 0.42
R7484:Rp1 UTSW 1 4345481 missense probably benign 0.10
R7500:Rp1 UTSW 1 4311278 missense unknown
R7569:Rp1 UTSW 1 4284840 missense unknown
R7642:Rp1 UTSW 1 4147831 missense unknown
R7693:Rp1 UTSW 1 4347403 missense probably damaging 1.00
R7742:Rp1 UTSW 1 4170234 missense unknown
R7759:Rp1 UTSW 1 4344884 missense probably benign
R7784:Rp1 UTSW 1 4142658 missense unknown
R7816:Rp1 UTSW 1 4347703 missense probably damaging 0.98
R7866:Rp1 UTSW 1 4347701 missense probably benign 0.02
R8215:Rp1 UTSW 1 4245095 missense unknown
R8281:Rp1 UTSW 1 4347916 missense probably damaging 1.00
R8294:Rp1 UTSW 1 4345997 missense probably benign 0.09
R8309:Rp1 UTSW 1 4347089 missense probably benign 0.00
R8311:Rp1 UTSW 1 4348349 missense probably benign 0.11
R8500:Rp1 UTSW 1 4346590 missense possibly damaging 0.91
R8559:Rp1 UTSW 1 4349561 missense probably damaging 1.00
R8672:Rp1 UTSW 1 4348784 missense possibly damaging 0.55
R8688:Rp1 UTSW 1 4346405 missense probably benign 0.01
R8792:Rp1 UTSW 1 4024868 missense unknown
R8859:Rp1 UTSW 1 4349960 missense probably benign 0.07
R8945:Rp1 UTSW 1 4349594 missense probably benign 0.42
R8959:Rp1 UTSW 1 4349427 intron probably benign
R8979:Rp1 UTSW 1 4148714 missense unknown
R9126:Rp1 UTSW 1 4346913 missense probably damaging 0.99
R9156:Rp1 UTSW 1 4163938 missense unknown
R9160:Rp1 UTSW 1 4346497 missense probably benign 0.00
R9263:Rp1 UTSW 1 4348452 missense probably benign 0.25
R9263:Rp1 UTSW 1 4348937 missense probably benign 0.02
R9302:Rp1 UTSW 1 4346566 missense probably damaging 1.00
R9318:Rp1 UTSW 1 4348265 missense probably benign 0.09
R9414:Rp1 UTSW 1 4243618 missense unknown
R9474:Rp1 UTSW 1 4092615 critical splice donor site probably null
R9478:Rp1 UTSW 1 4347322 missense probably benign 0.06
R9529:Rp1 UTSW 1 4346224 missense probably benign
R9572:Rp1 UTSW 1 4348439 missense probably benign
R9673:Rp1 UTSW 1 4267569 missense unknown
R9709:Rp1 UTSW 1 4042032 missense unknown
R9716:Rp1 UTSW 1 4142610 critical splice donor site probably null
RF003:Rp1 UTSW 1 4344694 missense probably damaging 0.99
V1662:Rp1 UTSW 1 4349560 missense probably damaging 1.00
X0012:Rp1 UTSW 1 4347695 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTGCCTGGTTAAATCTAGTGGC -3'
(R):5'- TGAAGATGATAGGTCTAGAATTGCG -3'

Sequencing Primer
(F):5'- CAAATGGGATGGCAACCTGTGTG -3'
(R):5'- GTCATTATCTTCTGTTACAAGTAGA -3'
Posted On 2022-02-07