Incidental Mutation 'R9221:Nbea'
ID 699442
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Name neurobeachin
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9221 (G1)
Quality Score 217.468
Status Not validated
Chromosome 3
Chromosomal Location 55532616-56091122 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) AC to A at 55998393 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000029374
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,921,828 (GRCm39) D1128G probably damaging Het
Acsm3 A T 7: 119,368,131 (GRCm39) R116* probably null Het
Acte1 G T 7: 143,434,902 (GRCm39) probably null Het
Ahnak T A 19: 8,989,943 (GRCm39) D3742E probably damaging Het
Arhgef17 A G 7: 100,528,818 (GRCm39) S598P possibly damaging Het
Asxl2 T C 12: 3,552,310 (GRCm39) F1351L probably damaging Het
Atg7 C T 6: 114,672,588 (GRCm39) T267I possibly damaging Het
Bace2 A G 16: 97,209,692 (GRCm39) K202R probably benign Het
Bccip G T 7: 133,311,249 (GRCm39) V55L probably benign Het
Bpifa1 T A 2: 153,988,052 (GRCm39) H198Q possibly damaging Het
Btbd7 A G 12: 102,777,430 (GRCm39) Y466H probably damaging Het
Cdc45 A C 16: 18,605,521 (GRCm39) S480A probably benign Het
Cenpe T C 3: 134,935,839 (GRCm39) Y425H possibly damaging Het
Cep76 A C 18: 67,767,977 (GRCm39) M185R probably damaging Het
Chd5 G T 4: 152,456,122 (GRCm39) M930I probably damaging Het
Clstn2 G T 9: 97,343,395 (GRCm39) T684K probably benign Het
Col4a2 A G 8: 11,491,943 (GRCm39) N1270S possibly damaging Het
Crxos A G 7: 15,636,850 (GRCm39) H141R probably benign Het
Dcc A G 18: 71,553,433 (GRCm39) I741T possibly damaging Het
Ddx20 A T 3: 105,587,685 (GRCm39) C430* probably null Het
Dgki G A 6: 37,273,615 (GRCm39) T12M probably benign Het
Dock6 T C 9: 21,721,153 (GRCm39) N1676S possibly damaging Het
Exosc6 G A 8: 111,783,028 (GRCm39) R9H probably damaging Het
Fstl5 A G 3: 76,569,114 (GRCm39) Q589R probably damaging Het
Gm4846 T A 1: 166,324,959 (GRCm39) Y44F probably benign Het
Gpr15lg A G 14: 36,829,352 (GRCm39) S44P probably damaging Het
Gtf3c2 A C 5: 31,326,401 (GRCm39) I370R probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspg2 A G 4: 137,287,726 (GRCm39) M3696V possibly damaging Het
Itga1 A T 13: 115,166,695 (GRCm39) C167* probably null Het
Khdc4 T C 3: 88,593,853 (GRCm39) S81P probably benign Het
Kpna2 A G 11: 106,880,158 (GRCm39) S497P probably damaging Het
Krt77 T A 15: 101,774,064 (GRCm39) T197S probably damaging Het
Krtap6-5 T C 16: 88,844,655 (GRCm39) Y26C unknown Het
Lhfpl5 A T 17: 28,799,133 (GRCm39) D214V possibly damaging Het
Lrrtm1 A G 6: 77,221,596 (GRCm39) E351G probably damaging Het
Mphosph9 A G 5: 124,403,427 (GRCm39) V867A probably benign Het
Mtcl1 T A 17: 66,650,879 (GRCm39) M1529L probably benign Het
Mthfr A T 4: 148,132,626 (GRCm39) Q268L probably damaging Het
Myo1d A T 11: 80,565,744 (GRCm39) N360K probably damaging Het
Or1e33 A T 11: 73,738,108 (GRCm39) V281E probably damaging Het
Or4p8 T C 2: 88,727,255 (GRCm39) S229G probably benign Het
Or5an1b A T 19: 12,299,336 (GRCm39) M285K probably damaging Het
Or5m11 T A 2: 85,782,185 (GRCm39) Y259* probably null Het
P2rx5 A T 11: 73,062,655 (GRCm39) T455S probably damaging Het
Palld A T 8: 61,969,591 (GRCm39) F1244L unknown Het
Pbld1 A G 10: 62,907,829 (GRCm39) T125A Het
Pde3b G A 7: 114,014,697 (GRCm39) probably benign Het
Pfkm T C 15: 98,019,188 (GRCm39) S180P probably damaging Het
Pla2g4d T A 2: 120,100,453 (GRCm39) R626S possibly damaging Het
Postn A G 3: 54,282,515 (GRCm39) E492G possibly damaging Het
Prph2 A G 17: 47,230,818 (GRCm39) D237G probably damaging Het
Psmd4 T C 3: 94,942,604 (GRCm39) H105R probably damaging Het
Pygl T C 12: 70,242,401 (GRCm39) N685S probably damaging Het
Rp1 A G 1: 4,315,266 (GRCm39) F502S unknown Het
Sik1 T C 17: 32,066,167 (GRCm39) I607V probably benign Het
Slc26a3 T A 12: 31,513,470 (GRCm39) I464N possibly damaging Het
Slc38a9 A G 13: 112,825,910 (GRCm39) N116S probably damaging Het
Sorcs2 C A 5: 36,181,910 (GRCm39) probably null Het
Spink5 T C 18: 44,119,367 (GRCm39) L226P probably damaging Het
Tab1 G A 15: 80,034,754 (GRCm39) V180I probably benign Het
Tacc2 T G 7: 130,226,058 (GRCm39) S914R probably damaging Het
Tacc2 C T 7: 130,226,209 (GRCm39) R965C probably benign Het
Tlr9 A G 9: 106,101,972 (GRCm39) D421G probably damaging Het
Tmem181a T C 17: 6,307,265 (GRCm39) L16P probably damaging Het
Trim58 A T 11: 58,542,075 (GRCm39) H345L probably damaging Het
Ttc13 G A 8: 125,400,290 (GRCm39) R688C probably benign Het
Ube2o C A 11: 116,433,664 (GRCm39) V685L probably damaging Het
Uso1 A G 5: 92,335,173 (GRCm39) H511R probably benign Het
Vmn2r5 A T 3: 64,411,721 (GRCm39) Y282* probably null Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55,535,914 (GRCm39) missense probably damaging 1.00
IGL00541:Nbea APN 3 55,875,510 (GRCm39) missense probably benign 0.02
IGL00584:Nbea APN 3 55,989,869 (GRCm39) missense probably damaging 0.98
IGL00648:Nbea APN 3 55,916,681 (GRCm39) missense probably damaging 0.98
IGL00785:Nbea APN 3 55,862,814 (GRCm39) missense probably benign
IGL00899:Nbea APN 3 55,550,266 (GRCm39) missense probably benign 0.32
IGL00955:Nbea APN 3 55,912,893 (GRCm39) missense possibly damaging 0.45
IGL01296:Nbea APN 3 55,938,957 (GRCm39) missense probably benign 0.04
IGL01299:Nbea APN 3 55,598,315 (GRCm39) missense probably damaging 1.00
IGL01393:Nbea APN 3 55,912,729 (GRCm39) missense probably benign 0.02
IGL01550:Nbea APN 3 55,712,669 (GRCm39) missense possibly damaging 0.93
IGL02023:Nbea APN 3 55,588,437 (GRCm39) missense probably damaging 1.00
IGL02034:Nbea APN 3 55,875,577 (GRCm39) missense probably damaging 1.00
IGL02061:Nbea APN 3 55,625,308 (GRCm39) missense possibly damaging 0.54
IGL02082:Nbea APN 3 55,875,588 (GRCm39) missense possibly damaging 0.88
IGL02113:Nbea APN 3 55,899,913 (GRCm39) missense probably benign
IGL02188:Nbea APN 3 55,891,258 (GRCm39) missense probably benign 0.00
IGL02319:Nbea APN 3 55,893,159 (GRCm39) missense probably damaging 1.00
IGL02406:Nbea APN 3 55,993,687 (GRCm39) missense probably benign 0.02
IGL02494:Nbea APN 3 55,712,772 (GRCm39) missense probably benign 0.02
IGL02550:Nbea APN 3 55,926,835 (GRCm39) missense probably damaging 0.98
IGL02706:Nbea APN 3 55,944,699 (GRCm39) missense probably damaging 1.00
IGL02718:Nbea APN 3 55,539,483 (GRCm39) nonsense probably null
IGL02822:Nbea APN 3 55,926,868 (GRCm39) missense possibly damaging 0.93
IGL02885:Nbea APN 3 55,539,407 (GRCm39) missense probably benign 0.01
IGL03000:Nbea APN 3 55,912,048 (GRCm39) missense possibly damaging 0.94
IGL03081:Nbea APN 3 55,987,339 (GRCm39) missense probably damaging 1.00
IGL03091:Nbea APN 3 55,992,725 (GRCm39) missense probably damaging 1.00
IGL03368:Nbea APN 3 55,987,351 (GRCm39) missense probably damaging 0.98
Neches UTSW 3 55,860,455 (GRCm39) critical splice donor site probably null
scotland UTSW 3 55,534,329 (GRCm39) missense probably damaging 1.00
Wales UTSW 3 55,998,540 (GRCm39) missense probably damaging 1.00
FR4340:Nbea UTSW 3 55,916,633 (GRCm39) critical splice donor site probably benign
G4846:Nbea UTSW 3 55,994,918 (GRCm39) missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55,625,290 (GRCm39) missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55,608,948 (GRCm39) intron probably benign
R0087:Nbea UTSW 3 55,998,444 (GRCm39) missense possibly damaging 0.92
R0220:Nbea UTSW 3 55,912,724 (GRCm39) missense probably benign 0.30
R0324:Nbea UTSW 3 55,965,369 (GRCm39) critical splice donor site probably null
R0330:Nbea UTSW 3 55,550,238 (GRCm39) missense probably benign 0.27
R0391:Nbea UTSW 3 55,944,698 (GRCm39) missense probably damaging 1.00
R0394:Nbea UTSW 3 55,937,328 (GRCm39) missense probably damaging 1.00
R0419:Nbea UTSW 3 55,726,715 (GRCm39) missense probably benign 0.05
R0503:Nbea UTSW 3 55,550,257 (GRCm39) missense possibly damaging 0.79
R0521:Nbea UTSW 3 55,915,689 (GRCm39) missense probably damaging 1.00
R0595:Nbea UTSW 3 55,535,917 (GRCm39) missense probably benign 0.18
R0894:Nbea UTSW 3 55,916,761 (GRCm39) missense possibly damaging 0.89
R1072:Nbea UTSW 3 55,993,617 (GRCm39) missense possibly damaging 0.94
R1125:Nbea UTSW 3 55,764,427 (GRCm39) nonsense probably null
R1169:Nbea UTSW 3 55,875,744 (GRCm39) missense probably benign 0.00
R1241:Nbea UTSW 3 55,965,461 (GRCm39) missense probably damaging 1.00
R1269:Nbea UTSW 3 55,912,202 (GRCm39) missense probably benign 0.05
R1406:Nbea UTSW 3 55,944,702 (GRCm39) missense probably benign 0.00
R1406:Nbea UTSW 3 55,944,702 (GRCm39) missense probably benign 0.00
R1457:Nbea UTSW 3 55,992,748 (GRCm39) missense probably damaging 1.00
R1482:Nbea UTSW 3 55,987,414 (GRCm39) missense probably damaging 1.00
R1483:Nbea UTSW 3 55,910,211 (GRCm39) missense probably benign 0.25
R1502:Nbea UTSW 3 55,912,310 (GRCm39) missense probably benign 0.03
R1544:Nbea UTSW 3 55,966,248 (GRCm39) missense probably damaging 0.99
R1629:Nbea UTSW 3 55,910,312 (GRCm39) missense possibly damaging 0.52
R1647:Nbea UTSW 3 55,537,650 (GRCm39) missense probably damaging 0.97
R1663:Nbea UTSW 3 55,553,407 (GRCm39) missense possibly damaging 0.95
R1722:Nbea UTSW 3 55,573,116 (GRCm39) missense probably damaging 1.00
R1757:Nbea UTSW 3 55,537,610 (GRCm39) missense possibly damaging 0.83
R1771:Nbea UTSW 3 55,841,940 (GRCm39) missense probably benign 0.00
R1796:Nbea UTSW 3 55,551,129 (GRCm39) missense possibly damaging 0.48
R1844:Nbea UTSW 3 55,989,857 (GRCm39) missense probably damaging 0.97
R1872:Nbea UTSW 3 55,550,310 (GRCm39) missense probably benign 0.12
R1938:Nbea UTSW 3 55,992,743 (GRCm39) missense probably damaging 1.00
R1940:Nbea UTSW 3 55,860,521 (GRCm39) missense possibly damaging 0.78
R2062:Nbea UTSW 3 55,993,578 (GRCm39) splice site probably benign
R2066:Nbea UTSW 3 55,875,567 (GRCm39) missense probably damaging 1.00
R2097:Nbea UTSW 3 55,630,638 (GRCm39) missense probably damaging 0.96
R2181:Nbea UTSW 3 55,937,360 (GRCm39) missense possibly damaging 0.92
R2274:Nbea UTSW 3 55,895,506 (GRCm39) splice site probably null
R2345:Nbea UTSW 3 55,992,700 (GRCm39) missense probably damaging 1.00
R2423:Nbea UTSW 3 55,992,727 (GRCm39) missense probably damaging 1.00
R2434:Nbea UTSW 3 55,554,881 (GRCm39) missense possibly damaging 0.91
R2880:Nbea UTSW 3 55,554,779 (GRCm39) missense probably benign 0.04
R2881:Nbea UTSW 3 55,554,779 (GRCm39) missense probably benign 0.04
R2940:Nbea UTSW 3 55,842,045 (GRCm39) missense probably benign 0.24
R3500:Nbea UTSW 3 55,588,431 (GRCm39) missense possibly damaging 0.88
R3765:Nbea UTSW 3 55,912,970 (GRCm39) missense probably damaging 1.00
R3790:Nbea UTSW 3 55,912,450 (GRCm39) missense probably benign
R3808:Nbea UTSW 3 55,625,269 (GRCm39) missense probably benign 0.02
R3845:Nbea UTSW 3 55,993,713 (GRCm39) splice site probably benign
R4182:Nbea UTSW 3 55,915,848 (GRCm39) missense probably damaging 0.99
R4385:Nbea UTSW 3 55,908,059 (GRCm39) missense possibly damaging 0.77
R4419:Nbea UTSW 3 55,917,021 (GRCm39) missense probably damaging 1.00
R4426:Nbea UTSW 3 55,989,800 (GRCm39) missense probably damaging 0.98
R4451:Nbea UTSW 3 55,899,753 (GRCm39) critical splice donor site probably null
R4456:Nbea UTSW 3 55,551,205 (GRCm39) missense probably benign 0.00
R4604:Nbea UTSW 3 55,631,069 (GRCm39) missense probably benign 0.18
R4687:Nbea UTSW 3 55,965,486 (GRCm39) missense probably damaging 1.00
R4758:Nbea UTSW 3 55,912,824 (GRCm39) missense probably benign
R4840:Nbea UTSW 3 55,618,091 (GRCm39) missense probably benign 0.37
R4888:Nbea UTSW 3 55,912,776 (GRCm39) missense possibly damaging 0.61
R4954:Nbea UTSW 3 55,943,379 (GRCm39) missense probably damaging 1.00
R4972:Nbea UTSW 3 55,992,667 (GRCm39) missense probably damaging 0.99
R4980:Nbea UTSW 3 55,860,466 (GRCm39) missense probably benign 0.00
R4980:Nbea UTSW 3 55,554,772 (GRCm39) splice site probably null
R5104:Nbea UTSW 3 55,987,348 (GRCm39) missense probably damaging 1.00
R5139:Nbea UTSW 3 55,534,384 (GRCm39) missense possibly damaging 0.90
R5166:Nbea UTSW 3 55,926,874 (GRCm39) missense probably damaging 1.00
R5347:Nbea UTSW 3 55,948,297 (GRCm39) missense probably damaging 1.00
R5350:Nbea UTSW 3 55,926,845 (GRCm39) missense probably damaging 1.00
R5418:Nbea UTSW 3 55,553,410 (GRCm39) missense possibly damaging 0.86
R5586:Nbea UTSW 3 55,539,392 (GRCm39) missense probably benign 0.08
R5627:Nbea UTSW 3 55,899,766 (GRCm39) missense probably damaging 1.00
R5683:Nbea UTSW 3 55,536,007 (GRCm39) missense possibly damaging 0.53
R5765:Nbea UTSW 3 55,912,719 (GRCm39) missense probably benign 0.15
R5853:Nbea UTSW 3 55,899,822 (GRCm39) missense probably damaging 1.00
R5858:Nbea UTSW 3 55,860,455 (GRCm39) critical splice donor site probably null
R5955:Nbea UTSW 3 55,588,404 (GRCm39) missense probably benign 0.00
R5976:Nbea UTSW 3 55,761,268 (GRCm39) missense probably benign 0.30
R6039:Nbea UTSW 3 55,912,538 (GRCm39) missense probably benign 0.00
R6039:Nbea UTSW 3 55,912,538 (GRCm39) missense probably benign 0.00
R6043:Nbea UTSW 3 55,693,896 (GRCm39) missense probably benign 0.32
R6122:Nbea UTSW 3 55,937,317 (GRCm39) missense probably damaging 1.00
R6218:Nbea UTSW 3 55,535,905 (GRCm39) missense probably damaging 0.97
R6331:Nbea UTSW 3 55,908,037 (GRCm39) missense possibly damaging 0.94
R6334:Nbea UTSW 3 55,944,570 (GRCm39) missense probably damaging 1.00
R6393:Nbea UTSW 3 55,998,540 (GRCm39) missense probably damaging 1.00
R6411:Nbea UTSW 3 55,712,778 (GRCm39) missense probably benign 0.01
R6457:Nbea UTSW 3 55,907,990 (GRCm39) missense probably damaging 1.00
R6476:Nbea UTSW 3 55,912,227 (GRCm39) missense probably benign 0.00
R6488:Nbea UTSW 3 55,625,264 (GRCm39) missense probably damaging 0.99
R6700:Nbea UTSW 3 55,989,869 (GRCm39) missense possibly damaging 0.89
R6702:Nbea UTSW 3 55,912,923 (GRCm39) missense probably benign 0.06
R6752:Nbea UTSW 3 55,944,640 (GRCm39) missense probably benign
R6752:Nbea UTSW 3 55,875,730 (GRCm39) missense probably benign 0.02
R6804:Nbea UTSW 3 55,994,874 (GRCm39) missense probably benign 0.37
R6901:Nbea UTSW 3 55,926,836 (GRCm39) missense probably damaging 1.00
R6933:Nbea UTSW 3 55,631,031 (GRCm39) missense possibly damaging 0.63
R7124:Nbea UTSW 3 55,899,865 (GRCm39) missense probably damaging 1.00
R7211:Nbea UTSW 3 55,912,322 (GRCm39) missense probably benign 0.05
R7308:Nbea UTSW 3 55,998,452 (GRCm39) missense probably damaging 1.00
R7405:Nbea UTSW 3 55,712,687 (GRCm39) missense possibly damaging 0.94
R7669:Nbea UTSW 3 55,625,200 (GRCm39) missense probably damaging 1.00
R7762:Nbea UTSW 3 55,557,126 (GRCm39) missense probably damaging 1.00
R7833:Nbea UTSW 3 55,910,218 (GRCm39) missense probably damaging 1.00
R7885:Nbea UTSW 3 55,573,110 (GRCm39) missense probably damaging 0.97
R7935:Nbea UTSW 3 55,966,086 (GRCm39) missense probably damaging 1.00
R8050:Nbea UTSW 3 55,895,402 (GRCm39) missense probably damaging 0.99
R8108:Nbea UTSW 3 55,726,736 (GRCm39) missense probably benign 0.11
R8290:Nbea UTSW 3 55,966,056 (GRCm39) nonsense probably null
R8314:Nbea UTSW 3 55,916,672 (GRCm39) missense probably damaging 0.99
R8321:Nbea UTSW 3 56,090,518 (GRCm39) missense possibly damaging 0.86
R8376:Nbea UTSW 3 55,551,076 (GRCm39) missense possibly damaging 0.79
R8410:Nbea UTSW 3 55,944,684 (GRCm39) missense probably damaging 1.00
R8556:Nbea UTSW 3 55,554,807 (GRCm39) missense probably benign 0.25
R8753:Nbea UTSW 3 55,534,329 (GRCm39) missense probably damaging 1.00
R8844:Nbea UTSW 3 55,998,415 (GRCm39) missense probably damaging 0.97
R8884:Nbea UTSW 3 55,712,720 (GRCm39) missense probably benign 0.00
R8886:Nbea UTSW 3 55,966,148 (GRCm39) missense probably damaging 1.00
R8890:Nbea UTSW 3 55,926,784 (GRCm39) splice site probably benign
R9004:Nbea UTSW 3 55,910,359 (GRCm39) missense probably benign 0.01
R9022:Nbea UTSW 3 55,551,110 (GRCm39) missense possibly damaging 0.79
R9080:Nbea UTSW 3 55,912,516 (GRCm39) nonsense probably null
R9087:Nbea UTSW 3 55,550,157 (GRCm39) critical splice donor site probably null
R9104:Nbea UTSW 3 55,862,809 (GRCm39) missense probably benign
R9165:Nbea UTSW 3 55,912,289 (GRCm39) missense probably benign 0.15
R9219:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9222:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9260:Nbea UTSW 3 55,891,233 (GRCm39) missense possibly damaging 0.50
R9263:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9265:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9294:Nbea UTSW 3 55,998,513 (GRCm39) missense probably benign 0.00
R9360:Nbea UTSW 3 55,943,319 (GRCm39) missense possibly damaging 0.96
R9387:Nbea UTSW 3 55,898,460 (GRCm39) missense probably benign 0.12
R9428:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9435:Nbea UTSW 3 55,943,309 (GRCm39) missense possibly damaging 0.63
R9507:Nbea UTSW 3 55,573,011 (GRCm39) missense probably damaging 1.00
R9514:Nbea UTSW 3 55,937,366 (GRCm39) missense probably damaging 1.00
R9516:Nbea UTSW 3 55,937,366 (GRCm39) missense probably damaging 1.00
R9674:Nbea UTSW 3 55,966,183 (GRCm39) missense probably damaging 1.00
R9688:Nbea UTSW 3 55,557,165 (GRCm39) missense probably benign 0.42
R9709:Nbea UTSW 3 55,693,879 (GRCm39) nonsense probably null
RF051:Nbea UTSW 3 55,916,633 (GRCm39) critical splice donor site probably benign
X0018:Nbea UTSW 3 55,943,469 (GRCm39) missense probably benign 0.39
Z1088:Nbea UTSW 3 55,630,584 (GRCm39) missense probably benign 0.34
Z1177:Nbea UTSW 3 55,938,971 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGGAACTTGGTGAATAGCTC -3'
(R):5'- TGGTGTTGGAAATGGCCTCC -3'

Sequencing Primer
(F):5'- GAACTTGGTGAATAGCTCTGAAC -3'
(R):5'- CCCATGTCAGTTCTGCTTACAG -3'
Posted On 2022-02-07