Mutagenetix > Incidental Mutation

Incidental Mutation 'R9221:Uso1'

699455

Institutional Source

Beutler Lab

Gene Symbol

Uso1

Ensembl Gene

ENSMUSG00000029407

Gene Name

USO1 vesicle docking factor

Synonyms

Vdp, TAP, transcytosis associated protein p115

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9221 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92137938-92202798 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92187314 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 511 (H511R)

Ref Sequence

ENSEMBL: ENSMUSP00000031355 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031355] [ENSMUST00000201642] [ENSMUST00000202155]

AlphaFold

Q9Z1Z0

Predicted Effect

probably benign
Transcript: ENSMUST00000031355
AA Change: H511R

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000031355
Gene: ENSMUSG00000029407
AA Change: H511R

Domain	Start	End	E-Value	Type
Blast:ARM	47	91	1e-18	BLAST
low complexity region	94	100	N/A	INTRINSIC
Blast:ARM	155	195	2e-15	BLAST
Blast:ARM	300	342	3e-19	BLAST
Pfam:Uso1_p115_head	344	628	6.5e-72	PFAM
low complexity region	630	643	N/A	INTRINSIC
low complexity region	661	672	N/A	INTRINSIC
low complexity region	730	744	N/A	INTRINSIC
Pfam:Uso1_p115_C	782	954	1.6e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201642

SMART Domains

Protein: ENSMUSP00000144165
Gene: ENSMUSG00000029407

Domain	Start	End	E-Value	Type
PDB:3GRL\|A	1	52	5e-24	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202155
AA Change: H511R

PolyPhen 2 Score 0.547 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000144592
Gene: ENSMUSG00000029407
AA Change: H511R

Domain	Start	End	E-Value	Type
Blast:ARM	47	91	1e-18	BLAST
low complexity region	94	100	N/A	INTRINSIC
Blast:ARM	155	195	2e-15	BLAST
Blast:ARM	300	342	3e-19	BLAST
Pfam:Uso1_p115_head	344	628	5.7e-72	PFAM
low complexity region	630	643	N/A	INTRINSIC
low complexity region	661	672	N/A	INTRINSIC
Pfam:Uso1_p115_C	730	892	2.1e-14	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality between E3.5 and E8.5 with disruption of Golgi apparatus in blastocyst cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610528A11Rik	A	G	14: 37,107,395	S44P	probably damaging	Het
2810403A07Rik	T	C	3: 88,686,546	S81P	probably benign	Het
Abca4	A	G	3: 122,128,179	D1128G	probably damaging	Het
Acsm3	A	T	7: 119,768,908	R116*	probably null	Het
Ahnak	T	A	19: 9,012,579	D3742E	probably damaging	Het
Arhgef17	A	G	7: 100,879,611	S598P	possibly damaging	Het
Asxl2	T	C	12: 3,502,310	F1351L	probably damaging	Het
Atg7	C	T	6: 114,695,627	T267I	possibly damaging	Het
Bace2	A	G	16: 97,408,492	K202R	probably benign	Het
Bccip	G	T	7: 133,709,520	V55L	probably benign	Het
Bpifa1	T	A	2: 154,146,132	H198Q	possibly damaging	Het
Btbd7	A	G	12: 102,811,171	Y466H	probably damaging	Het
Cdc45	A	C	16: 18,786,771	S480A	probably benign	Het
Cenpe	T	C	3: 135,230,078	Y425H	possibly damaging	Het
Cep76	A	C	18: 67,634,907	M185R	probably damaging	Het
Chd5	G	T	4: 152,371,665	M930I	probably damaging	Het
Clstn2	G	T	9: 97,461,342	T684K	probably benign	Het
Col4a2	A	G	8: 11,441,943	N1270S	possibly damaging	Het
Crxos	A	G	7: 15,902,925	H141R	probably benign	Het
Dcc	A	G	18: 71,420,362	I741T	possibly damaging	Het
Ddx20	A	T	3: 105,680,369	C430*	probably null	Het
Dgki	G	A	6: 37,296,680	T12M	probably benign	Het
Dock6	T	C	9: 21,809,857	N1676S	possibly damaging	Het
Exosc6	G	A	8: 111,056,396	R9H	probably damaging	Het
Fstl5	A	G	3: 76,661,807	Q589R	probably damaging	Het
Gm4846	T	A	1: 166,497,390	Y44F	probably benign	Het
Gm498	G	T	7: 143,881,165		probably null	Het
Gtf3c2	A	C	5: 31,169,057	I370R	probably damaging	Het
Hjurp	CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT	C	1: 88,266,277		probably benign	Het
Hspg2	A	G	4: 137,560,415	M3696V	possibly damaging	Het
Itga1	A	T	13: 115,030,159	C167*	probably null	Het
Kpna2	A	G	11: 106,989,332	S497P	probably damaging	Het
Krt77	T	A	15: 101,865,629	T197S	probably damaging	Het
Krtap6-5	T	C	16: 89,047,767	Y26C	unknown	Het
Lhfpl5	A	T	17: 28,580,159	D214V	possibly damaging	Het
Lrrtm1	A	G	6: 77,244,613	E351G	probably damaging	Het
Mphosph9	A	G	5: 124,265,364	V867A	probably benign	Het
Mtcl1	T	A	17: 66,343,884	M1529L	probably benign	Het
Mthfr	A	T	4: 148,048,169	Q268L	probably damaging	Het
Myo1d	A	T	11: 80,674,918	N360K	probably damaging	Het
Nbea	AC	A	3: 56,090,972		probably null	Het
Olfr1028	T	A	2: 85,951,841	Y259*	probably null	Het
Olfr1208	T	C	2: 88,896,911	S229G	probably benign	Het
Olfr1437	A	T	19: 12,321,972	M285K	probably damaging	Het
Olfr393	A	T	11: 73,847,282	V281E	probably damaging	Het
P2rx5	A	T	11: 73,171,829	T455S	probably damaging	Het
Palld	A	T	8: 61,516,557	F1244L	unknown	Het
Pbld1	A	G	10: 63,072,050	T125A		Het
Pde3b	G	A	7: 114,415,462		probably benign	Het
Pfkm	T	C	15: 98,121,307	S180P	probably damaging	Het
Pla2g4d	T	A	2: 120,269,972	R626S	possibly damaging	Het
Postn	A	G	3: 54,375,094	E492G	possibly damaging	Het
Prph2	A	G	17: 46,919,892	D237G	probably damaging	Het
Psmd4	T	C	3: 95,035,293	H105R	probably damaging	Het
Pygl	T	C	12: 70,195,627	N685S	probably damaging	Het
Rp1	A	G	1: 4,245,043	F502S	unknown	Het
Sik1	T	C	17: 31,847,193	I607V	probably benign	Het
Slc26a3	T	A	12: 31,463,471	I464N	possibly damaging	Het
Slc38a9	A	G	13: 112,689,376	N116S	probably damaging	Het
Sorcs2	C	A	5: 36,024,566		probably null	Het
Spink5	T	C	18: 43,986,300	L226P	probably damaging	Het
Tab1	G	A	15: 80,150,553	V180I	probably benign	Het
Tacc2	T	G	7: 130,624,328	S914R	probably damaging	Het
Tacc2	C	T	7: 130,624,479	R965C	probably benign	Het
Tlr9	A	G	9: 106,224,773	D421G	probably damaging	Het
Tmem181a	T	C	17: 6,256,990	L16P	probably damaging	Het
Trim58	A	T	11: 58,651,249	H345L	probably damaging	Het
Ttc13	G	A	8: 124,673,551	R688C	probably benign	Het
Ube2o	C	A	11: 116,542,838	V685L	probably damaging	Het
Vmn2r5	A	T	3: 64,504,300	Y282*	probably null	Het

Other mutations in Uso1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01522:Uso1	APN	5	92181419	missense	probably damaging	0.96
IGL01753:Uso1	APN	5	92152918	critical splice donor site	probably null
IGL02311:Uso1	APN	5	92187776	missense	probably benign
IGL02539:Uso1	APN	5	92187773	missense	probably damaging	1.00
IGL02716:Uso1	APN	5	92173935	missense	probably damaging	0.99
IGL03154:Uso1	APN	5	92180618	nonsense	probably null
R0558:Uso1	UTSW	5	92174019	missense	probably benign	0.03
R0570:Uso1	UTSW	5	92199823	missense	probably benign	0.19
R1195:Uso1	UTSW	5	92170747	missense	probably damaging	1.00
R1195:Uso1	UTSW	5	92170747	missense	probably damaging	1.00
R1195:Uso1	UTSW	5	92170747	missense	probably damaging	1.00
R1398:Uso1	UTSW	5	92181468	missense	probably benign	0.16
R1485:Uso1	UTSW	5	92180563	missense	possibly damaging	0.76
R1813:Uso1	UTSW	5	92201133	critical splice acceptor site	probably null
R1873:Uso1	UTSW	5	92192859	splice site	probably benign
R1896:Uso1	UTSW	5	92201133	critical splice acceptor site	probably null
R1899:Uso1	UTSW	5	92201192	missense	probably benign	0.27
R2049:Uso1	UTSW	5	92181936	missense	probably damaging	1.00
R2128:Uso1	UTSW	5	92195370	missense	probably benign
R2411:Uso1	UTSW	5	92158399	splice site	probably benign
R2903:Uso1	UTSW	5	92195435	critical splice donor site	probably null
R5055:Uso1	UTSW	5	92192735	missense	probably benign	0.31
R5155:Uso1	UTSW	5	92167335	critical splice donor site	probably null
R5590:Uso1	UTSW	5	92180608	missense	probably benign	0.05
R5665:Uso1	UTSW	5	92198337	missense	possibly damaging	0.95
R5677:Uso1	UTSW	5	92201299	missense	probably damaging	1.00
R5996:Uso1	UTSW	5	92192730	missense	probably benign	0.00
R6165:Uso1	UTSW	5	92187267	missense	probably damaging	1.00
R6340:Uso1	UTSW	5	92199852	missense	probably benign	0.01
R6701:Uso1	UTSW	5	92166585	missense	probably damaging	1.00
R6860:Uso1	UTSW	5	92195348	missense	probably benign	0.11
R7062:Uso1	UTSW	5	92192740	missense	possibly damaging	0.62
R7133:Uso1	UTSW	5	92158465	missense	probably benign	0.12
R7317:Uso1	UTSW	5	92173992	missense	possibly damaging	0.70
R7527:Uso1	UTSW	5	92199875	missense	possibly damaging	0.58
R7648:Uso1	UTSW	5	92194002	splice site	probably null
R7707:Uso1	UTSW	5	92201936	makesense	probably null
R8009:Uso1	UTSW	5	92166580	missense	probably benign	0.03
R8104:Uso1	UTSW	5	92158421	missense	probably damaging	0.99
R8361:Uso1	UTSW	5	92189262	missense	probably null	0.00
R8519:Uso1	UTSW	5	92195363	missense	probably benign
R9052:Uso1	UTSW	5	92180563	missense	probably damaging	1.00
R9142:Uso1	UTSW	5	92187266	nonsense	probably null
R9492:Uso1	UTSW	5	92167332	missense	possibly damaging	0.77
R9642:Uso1	UTSW	5	92138108	missense	probably damaging	1.00
Z1177:Uso1	UTSW	5	92138130	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TCGTCTGACTTCTGCACTGG -3'
(R):5'- AATCTGTCCTGTAAGCTGACATC -3'

Sequencing Primer
(F):5'- CGCAGCCTGTTGCAAAC -3'
(R):5'- CCTGTAAGCTGACATCTTTGTTAAGG -3'

Posted On

2022-02-07