Incidental Mutation 'R9221:Uso1'
ID 699455
Institutional Source Beutler Lab
Gene Symbol Uso1
Ensembl Gene ENSMUSG00000029407
Gene Name USO1 vesicle docking factor
Synonyms Vdp, TAP, transcytosis associated protein p115
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9221 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 92137938-92202798 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92187314 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 511 (H511R)
Ref Sequence ENSEMBL: ENSMUSP00000031355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031355] [ENSMUST00000201642] [ENSMUST00000202155]
AlphaFold Q9Z1Z0
Predicted Effect probably benign
Transcript: ENSMUST00000031355
AA Change: H511R

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031355
Gene: ENSMUSG00000029407
AA Change: H511R

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 6.5e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 730 744 N/A INTRINSIC
Pfam:Uso1_p115_C 782 954 1.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201642
SMART Domains Protein: ENSMUSP00000144165
Gene: ENSMUSG00000029407

DomainStartEndE-ValueType
PDB:3GRL|A 1 52 5e-24 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000202155
AA Change: H511R

PolyPhen 2 Score 0.547 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000144592
Gene: ENSMUSG00000029407
AA Change: H511R

DomainStartEndE-ValueType
Blast:ARM 47 91 1e-18 BLAST
low complexity region 94 100 N/A INTRINSIC
Blast:ARM 155 195 2e-15 BLAST
Blast:ARM 300 342 3e-19 BLAST
Pfam:Uso1_p115_head 344 628 5.7e-72 PFAM
low complexity region 630 643 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
Pfam:Uso1_p115_C 730 892 2.1e-14 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein which recycles between the cytosol and the Golgi apparatus during interphase. It is regulated by phosphorylation: dephosphorylated protein associates with the Golgi membrane and dissociates from the membrane upon phosphorylation. Ras-associated protein 1 recruits this protein to coat protein complex II (COPII) vesicles during budding from the endoplasmic reticulum, where it interacts with a set of COPII vesicle-associated SNAREs to form a cis-SNARE complex that promotes targeting to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality between E3.5 and E8.5 with disruption of Golgi apparatus in blastocyst cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610528A11Rik A G 14: 37,107,395 S44P probably damaging Het
2810403A07Rik T C 3: 88,686,546 S81P probably benign Het
Abca4 A G 3: 122,128,179 D1128G probably damaging Het
Acsm3 A T 7: 119,768,908 R116* probably null Het
Ahnak T A 19: 9,012,579 D3742E probably damaging Het
Arhgef17 A G 7: 100,879,611 S598P possibly damaging Het
Asxl2 T C 12: 3,502,310 F1351L probably damaging Het
Atg7 C T 6: 114,695,627 T267I possibly damaging Het
Bace2 A G 16: 97,408,492 K202R probably benign Het
Bccip G T 7: 133,709,520 V55L probably benign Het
Bpifa1 T A 2: 154,146,132 H198Q possibly damaging Het
Btbd7 A G 12: 102,811,171 Y466H probably damaging Het
Cdc45 A C 16: 18,786,771 S480A probably benign Het
Cenpe T C 3: 135,230,078 Y425H possibly damaging Het
Cep76 A C 18: 67,634,907 M185R probably damaging Het
Chd5 G T 4: 152,371,665 M930I probably damaging Het
Clstn2 G T 9: 97,461,342 T684K probably benign Het
Col4a2 A G 8: 11,441,943 N1270S possibly damaging Het
Crxos A G 7: 15,902,925 H141R probably benign Het
Dcc A G 18: 71,420,362 I741T possibly damaging Het
Ddx20 A T 3: 105,680,369 C430* probably null Het
Dgki G A 6: 37,296,680 T12M probably benign Het
Dock6 T C 9: 21,809,857 N1676S possibly damaging Het
Exosc6 G A 8: 111,056,396 R9H probably damaging Het
Fstl5 A G 3: 76,661,807 Q589R probably damaging Het
Gm4846 T A 1: 166,497,390 Y44F probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gtf3c2 A C 5: 31,169,057 I370R probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hspg2 A G 4: 137,560,415 M3696V possibly damaging Het
Itga1 A T 13: 115,030,159 C167* probably null Het
Kpna2 A G 11: 106,989,332 S497P probably damaging Het
Krt77 T A 15: 101,865,629 T197S probably damaging Het
Krtap6-5 T C 16: 89,047,767 Y26C unknown Het
Lhfpl5 A T 17: 28,580,159 D214V possibly damaging Het
Lrrtm1 A G 6: 77,244,613 E351G probably damaging Het
Mphosph9 A G 5: 124,265,364 V867A probably benign Het
Mtcl1 T A 17: 66,343,884 M1529L probably benign Het
Mthfr A T 4: 148,048,169 Q268L probably damaging Het
Myo1d A T 11: 80,674,918 N360K probably damaging Het
Nbea AC A 3: 56,090,972 probably null Het
Olfr1028 T A 2: 85,951,841 Y259* probably null Het
Olfr1208 T C 2: 88,896,911 S229G probably benign Het
Olfr1437 A T 19: 12,321,972 M285K probably damaging Het
Olfr393 A T 11: 73,847,282 V281E probably damaging Het
P2rx5 A T 11: 73,171,829 T455S probably damaging Het
Palld A T 8: 61,516,557 F1244L unknown Het
Pbld1 A G 10: 63,072,050 T125A Het
Pde3b G A 7: 114,415,462 probably benign Het
Pfkm T C 15: 98,121,307 S180P probably damaging Het
Pla2g4d T A 2: 120,269,972 R626S possibly damaging Het
Postn A G 3: 54,375,094 E492G possibly damaging Het
Prph2 A G 17: 46,919,892 D237G probably damaging Het
Psmd4 T C 3: 95,035,293 H105R probably damaging Het
Pygl T C 12: 70,195,627 N685S probably damaging Het
Rp1 A G 1: 4,245,043 F502S unknown Het
Sik1 T C 17: 31,847,193 I607V probably benign Het
Slc26a3 T A 12: 31,463,471 I464N possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Sorcs2 C A 5: 36,024,566 probably null Het
Spink5 T C 18: 43,986,300 L226P probably damaging Het
Tab1 G A 15: 80,150,553 V180I probably benign Het
Tacc2 T G 7: 130,624,328 S914R probably damaging Het
Tacc2 C T 7: 130,624,479 R965C probably benign Het
Tlr9 A G 9: 106,224,773 D421G probably damaging Het
Tmem181a T C 17: 6,256,990 L16P probably damaging Het
Trim58 A T 11: 58,651,249 H345L probably damaging Het
Ttc13 G A 8: 124,673,551 R688C probably benign Het
Ube2o C A 11: 116,542,838 V685L probably damaging Het
Vmn2r5 A T 3: 64,504,300 Y282* probably null Het
Other mutations in Uso1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01522:Uso1 APN 5 92181419 missense probably damaging 0.96
IGL01753:Uso1 APN 5 92152918 critical splice donor site probably null
IGL02311:Uso1 APN 5 92187776 missense probably benign
IGL02539:Uso1 APN 5 92187773 missense probably damaging 1.00
IGL02716:Uso1 APN 5 92173935 missense probably damaging 0.99
IGL03154:Uso1 APN 5 92180618 nonsense probably null
R0558:Uso1 UTSW 5 92174019 missense probably benign 0.03
R0570:Uso1 UTSW 5 92199823 missense probably benign 0.19
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1195:Uso1 UTSW 5 92170747 missense probably damaging 1.00
R1398:Uso1 UTSW 5 92181468 missense probably benign 0.16
R1485:Uso1 UTSW 5 92180563 missense possibly damaging 0.76
R1813:Uso1 UTSW 5 92201133 critical splice acceptor site probably null
R1873:Uso1 UTSW 5 92192859 splice site probably benign
R1896:Uso1 UTSW 5 92201133 critical splice acceptor site probably null
R1899:Uso1 UTSW 5 92201192 missense probably benign 0.27
R2049:Uso1 UTSW 5 92181936 missense probably damaging 1.00
R2128:Uso1 UTSW 5 92195370 missense probably benign
R2411:Uso1 UTSW 5 92158399 splice site probably benign
R2903:Uso1 UTSW 5 92195435 critical splice donor site probably null
R5055:Uso1 UTSW 5 92192735 missense probably benign 0.31
R5155:Uso1 UTSW 5 92167335 critical splice donor site probably null
R5590:Uso1 UTSW 5 92180608 missense probably benign 0.05
R5665:Uso1 UTSW 5 92198337 missense possibly damaging 0.95
R5677:Uso1 UTSW 5 92201299 missense probably damaging 1.00
R5996:Uso1 UTSW 5 92192730 missense probably benign 0.00
R6165:Uso1 UTSW 5 92187267 missense probably damaging 1.00
R6340:Uso1 UTSW 5 92199852 missense probably benign 0.01
R6701:Uso1 UTSW 5 92166585 missense probably damaging 1.00
R6860:Uso1 UTSW 5 92195348 missense probably benign 0.11
R7062:Uso1 UTSW 5 92192740 missense possibly damaging 0.62
R7133:Uso1 UTSW 5 92158465 missense probably benign 0.12
R7317:Uso1 UTSW 5 92173992 missense possibly damaging 0.70
R7527:Uso1 UTSW 5 92199875 missense possibly damaging 0.58
R7648:Uso1 UTSW 5 92194002 splice site probably null
R7707:Uso1 UTSW 5 92201936 makesense probably null
R8009:Uso1 UTSW 5 92166580 missense probably benign 0.03
R8104:Uso1 UTSW 5 92158421 missense probably damaging 0.99
R8361:Uso1 UTSW 5 92189262 missense probably null 0.00
R8519:Uso1 UTSW 5 92195363 missense probably benign
R9052:Uso1 UTSW 5 92180563 missense probably damaging 1.00
R9142:Uso1 UTSW 5 92187266 nonsense probably null
R9492:Uso1 UTSW 5 92167332 missense possibly damaging 0.77
Z1177:Uso1 UTSW 5 92138130 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCGTCTGACTTCTGCACTGG -3'
(R):5'- AATCTGTCCTGTAAGCTGACATC -3'

Sequencing Primer
(F):5'- CGCAGCCTGTTGCAAAC -3'
(R):5'- CCTGTAAGCTGACATCTTTGTTAAGG -3'
Posted On 2022-02-07