Incidental Mutation 'R9221:Cdc45'
ID 699492
Institutional Source Beutler Lab
Gene Symbol Cdc45
Ensembl Gene ENSMUSG00000000028
Gene Name cell division cycle 45
Synonyms Cdc45l
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9221 (G1)
Quality Score 194.009
Status Not validated
Chromosome 16
Chromosomal Location 18780447-18811987 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 18786771 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Alanine at position 480 (S480A)
Ref Sequence ENSEMBL: ENSMUSP00000000028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000028] [ENSMUST00000096990]
AlphaFold Q9Z1X9
Predicted Effect probably benign
Transcript: ENSMUST00000000028
AA Change: S480A

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000000028
Gene: ENSMUSG00000000028
AA Change: S480A

DomainStartEndE-ValueType
Pfam:CDC45 19 564 1.6e-152 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096990
AA Change: S434A

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000094753
Gene: ENSMUSG00000000028
AA Change: S434A

DomainStartEndE-ValueType
Pfam:CDC45 18 74 7.9e-24 PFAM
Pfam:CDC45 73 520 4.5e-138 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its strong similarity with Saccharomyces cerevisiae Cdc45, an essential protein required to the initiation of DNA replication. Cdc45 is a member of the highly conserved multiprotein complex including Cdc6/Cdc18, the minichromosome maintenance proteins (MCMs) and DNA polymerase, which is important for early steps of DNA replication in eukaryotes. This protein has been shown to interact with MCM7 and DNA polymerase alpha. Studies of the similar gene in Xenopus suggested that this protein play a pivotal role in the loading of DNA polymerase alpha onto chromatin. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous mutant embryos do not develop after implantation, resulting in embryonic lethality between E4.5-E5.5. Heterozygous animals appear normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610528A11Rik A G 14: 37,107,395 S44P probably damaging Het
2810403A07Rik T C 3: 88,686,546 S81P probably benign Het
Abca4 A G 3: 122,128,179 D1128G probably damaging Het
Acsm3 A T 7: 119,768,908 R116* probably null Het
Ahnak T A 19: 9,012,579 D3742E probably damaging Het
Arhgef17 A G 7: 100,879,611 S598P possibly damaging Het
Asxl2 T C 12: 3,502,310 F1351L probably damaging Het
Atg7 C T 6: 114,695,627 T267I possibly damaging Het
Bace2 A G 16: 97,408,492 K202R probably benign Het
Bccip G T 7: 133,709,520 V55L probably benign Het
Bpifa1 T A 2: 154,146,132 H198Q possibly damaging Het
Btbd7 A G 12: 102,811,171 Y466H probably damaging Het
Cenpe T C 3: 135,230,078 Y425H possibly damaging Het
Cep76 A C 18: 67,634,907 M185R probably damaging Het
Chd5 G T 4: 152,371,665 M930I probably damaging Het
Clstn2 G T 9: 97,461,342 T684K probably benign Het
Col4a2 A G 8: 11,441,943 N1270S possibly damaging Het
Crxos A G 7: 15,902,925 H141R probably benign Het
Dcc A G 18: 71,420,362 I741T possibly damaging Het
Ddx20 A T 3: 105,680,369 C430* probably null Het
Dgki G A 6: 37,296,680 T12M probably benign Het
Dock6 T C 9: 21,809,857 N1676S possibly damaging Het
Exosc6 G A 8: 111,056,396 R9H probably damaging Het
Fstl5 A G 3: 76,661,807 Q589R probably damaging Het
Gm4846 T A 1: 166,497,390 Y44F probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gtf3c2 A C 5: 31,169,057 I370R probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hspg2 A G 4: 137,560,415 M3696V possibly damaging Het
Itga1 A T 13: 115,030,159 C167* probably null Het
Kpna2 A G 11: 106,989,332 S497P probably damaging Het
Krt77 T A 15: 101,865,629 T197S probably damaging Het
Krtap6-5 T C 16: 89,047,767 Y26C unknown Het
Lhfpl5 A T 17: 28,580,159 D214V possibly damaging Het
Lrrtm1 A G 6: 77,244,613 E351G probably damaging Het
Mphosph9 A G 5: 124,265,364 V867A probably benign Het
Mtcl1 T A 17: 66,343,884 M1529L probably benign Het
Mthfr A T 4: 148,048,169 Q268L probably damaging Het
Myo1d A T 11: 80,674,918 N360K probably damaging Het
Nbea AC A 3: 56,090,972 probably null Het
Olfr1028 T A 2: 85,951,841 Y259* probably null Het
Olfr1208 T C 2: 88,896,911 S229G probably benign Het
Olfr1437 A T 19: 12,321,972 M285K probably damaging Het
Olfr393 A T 11: 73,847,282 V281E probably damaging Het
P2rx5 A T 11: 73,171,829 T455S probably damaging Het
Palld A T 8: 61,516,557 F1244L unknown Het
Pbld1 A G 10: 63,072,050 T125A Het
Pde3b G A 7: 114,415,462 probably benign Het
Pfkm T C 15: 98,121,307 S180P probably damaging Het
Pla2g4d T A 2: 120,269,972 R626S possibly damaging Het
Postn A G 3: 54,375,094 E492G possibly damaging Het
Prph2 A G 17: 46,919,892 D237G probably damaging Het
Psmd4 T C 3: 95,035,293 H105R probably damaging Het
Pygl T C 12: 70,195,627 N685S probably damaging Het
Rp1 A G 1: 4,245,043 F502S unknown Het
Sik1 T C 17: 31,847,193 I607V probably benign Het
Slc26a3 T A 12: 31,463,471 I464N possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Sorcs2 C A 5: 36,024,566 probably null Het
Spink5 T C 18: 43,986,300 L226P probably damaging Het
Tab1 G A 15: 80,150,553 V180I probably benign Het
Tacc2 T G 7: 130,624,328 S914R probably damaging Het
Tacc2 C T 7: 130,624,479 R965C probably benign Het
Tlr9 A G 9: 106,224,773 D421G probably damaging Het
Tmem181a T C 17: 6,256,990 L16P probably damaging Het
Trim58 A T 11: 58,651,249 H345L probably damaging Het
Ttc13 G A 8: 124,673,551 R688C probably benign Het
Ube2o C A 11: 116,542,838 V685L probably damaging Het
Uso1 A G 5: 92,187,314 H511R probably benign Het
Vmn2r5 A T 3: 64,504,300 Y282* probably null Het
Other mutations in Cdc45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01528:Cdc45 APN 16 18811561 missense probably damaging 1.00
IGL01677:Cdc45 APN 16 18787000 missense probably benign 0.02
IGL02079:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02080:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02105:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02106:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02237:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02238:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02239:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02371:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02441:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02442:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02465:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02466:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02468:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02469:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02470:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02471:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02472:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02473:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02489:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02490:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02491:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02492:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02511:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02558:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02559:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02560:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02561:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02562:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02566:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02567:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02576:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02583:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02589:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02626:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02627:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02628:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02629:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02687:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02688:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02689:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02720:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02724:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02731:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02738:Cdc45 APN 16 18798729 missense probably benign 0.06
IGL02991:Cdc45 UTSW 16 18798729 missense probably benign 0.06
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0051:Cdc45 UTSW 16 18794774 missense probably damaging 1.00
R0458:Cdc45 UTSW 16 18781972 splice site probably benign
R1398:Cdc45 UTSW 16 18781971 splice site probably benign
R1413:Cdc45 UTSW 16 18808741 missense possibly damaging 0.63
R1792:Cdc45 UTSW 16 18807340 missense probably benign 0.01
R2919:Cdc45 UTSW 16 18808793 missense probably benign 0.00
R3956:Cdc45 UTSW 16 18805430 missense probably benign 0.00
R4079:Cdc45 UTSW 16 18811360 missense probably damaging 1.00
R4825:Cdc45 UTSW 16 18784863 missense probably damaging 0.98
R5028:Cdc45 UTSW 16 18795180 missense probably benign 0.43
R5214:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5215:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5309:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5311:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5312:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5352:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5353:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5354:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5355:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5356:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5424:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5426:Cdc45 UTSW 16 18795897 missense probably damaging 1.00
R5655:Cdc45 UTSW 16 18807279 critical splice donor site probably null
R6174:Cdc45 UTSW 16 18794704 splice site probably null
R6796:Cdc45 UTSW 16 18784857 missense probably damaging 1.00
R7910:Cdc45 UTSW 16 18810453 missense probably damaging 0.98
R8519:Cdc45 UTSW 16 18808847 missense probably damaging 1.00
R8987:Cdc45 UTSW 16 18811550 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGCGACATAACTAGTGAGTGC -3'
(R):5'- TCTACTGCTCACTCATGGAGG -3'

Sequencing Primer
(F):5'- CTTGTAGGAAACTGGAAGGCTCC -3'
(R):5'- ACTGCTCACTCATGGAGGTTAGAC -3'
Posted On 2022-02-07