Incidental Mutation 'R9221:Lhfpl5'
ID 699496
Institutional Source Beutler Lab
Gene Symbol Lhfpl5
Ensembl Gene ENSMUSG00000062252
Gene Name lipoma HMGIC fusion partner-like 5
Synonyms Tmhs, 9330179O15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock # R9221 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 28575718-28583593 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 28580159 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 214 (D214V)
Ref Sequence ENSEMBL: ENSMUSP00000079598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080780]
AlphaFold Q4KL25
Predicted Effect possibly damaging
Transcript: ENSMUST00000080780
AA Change: D214V

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079598
Gene: ENSMUSG00000062252
AA Change: D214V

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 25 202 1.5e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in this gene result in deafness in humans, and a mutation in a similar gene in mice results in deafness and vestibular dysfunction with severe degeneration of the organ of Corti. It is proposed to function in hair bundle morphogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in deafness and vestibular dysfunction with severe degeneration of the organ of Corti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610528A11Rik A G 14: 37,107,395 S44P probably damaging Het
2810403A07Rik T C 3: 88,686,546 S81P probably benign Het
Abca4 A G 3: 122,128,179 D1128G probably damaging Het
Acsm3 A T 7: 119,768,908 R116* probably null Het
Ahnak T A 19: 9,012,579 D3742E probably damaging Het
Arhgef17 A G 7: 100,879,611 S598P possibly damaging Het
Asxl2 T C 12: 3,502,310 F1351L probably damaging Het
Atg7 C T 6: 114,695,627 T267I possibly damaging Het
Bace2 A G 16: 97,408,492 K202R probably benign Het
Bccip G T 7: 133,709,520 V55L probably benign Het
Bpifa1 T A 2: 154,146,132 H198Q possibly damaging Het
Btbd7 A G 12: 102,811,171 Y466H probably damaging Het
Cdc45 A C 16: 18,786,771 S480A probably benign Het
Cenpe T C 3: 135,230,078 Y425H possibly damaging Het
Cep76 A C 18: 67,634,907 M185R probably damaging Het
Chd5 G T 4: 152,371,665 M930I probably damaging Het
Clstn2 G T 9: 97,461,342 T684K probably benign Het
Col4a2 A G 8: 11,441,943 N1270S possibly damaging Het
Crxos A G 7: 15,902,925 H141R probably benign Het
Dcc A G 18: 71,420,362 I741T possibly damaging Het
Ddx20 A T 3: 105,680,369 C430* probably null Het
Dgki G A 6: 37,296,680 T12M probably benign Het
Dock6 T C 9: 21,809,857 N1676S possibly damaging Het
Exosc6 G A 8: 111,056,396 R9H probably damaging Het
Fstl5 A G 3: 76,661,807 Q589R probably damaging Het
Gm4846 T A 1: 166,497,390 Y44F probably benign Het
Gm498 G T 7: 143,881,165 probably null Het
Gtf3c2 A C 5: 31,169,057 I370R probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hspg2 A G 4: 137,560,415 M3696V possibly damaging Het
Itga1 A T 13: 115,030,159 C167* probably null Het
Kpna2 A G 11: 106,989,332 S497P probably damaging Het
Krt77 T A 15: 101,865,629 T197S probably damaging Het
Krtap6-5 T C 16: 89,047,767 Y26C unknown Het
Lrrtm1 A G 6: 77,244,613 E351G probably damaging Het
Mphosph9 A G 5: 124,265,364 V867A probably benign Het
Mtcl1 T A 17: 66,343,884 M1529L probably benign Het
Mthfr A T 4: 148,048,169 Q268L probably damaging Het
Myo1d A T 11: 80,674,918 N360K probably damaging Het
Nbea AC A 3: 56,090,972 probably null Het
Olfr1028 T A 2: 85,951,841 Y259* probably null Het
Olfr1208 T C 2: 88,896,911 S229G probably benign Het
Olfr1437 A T 19: 12,321,972 M285K probably damaging Het
Olfr393 A T 11: 73,847,282 V281E probably damaging Het
P2rx5 A T 11: 73,171,829 T455S probably damaging Het
Palld A T 8: 61,516,557 F1244L unknown Het
Pbld1 A G 10: 63,072,050 T125A Het
Pde3b G A 7: 114,415,462 probably benign Het
Pfkm T C 15: 98,121,307 S180P probably damaging Het
Pla2g4d T A 2: 120,269,972 R626S possibly damaging Het
Postn A G 3: 54,375,094 E492G possibly damaging Het
Prph2 A G 17: 46,919,892 D237G probably damaging Het
Psmd4 T C 3: 95,035,293 H105R probably damaging Het
Pygl T C 12: 70,195,627 N685S probably damaging Het
Rp1 A G 1: 4,245,043 F502S unknown Het
Sik1 T C 17: 31,847,193 I607V probably benign Het
Slc26a3 T A 12: 31,463,471 I464N possibly damaging Het
Slc38a9 A G 13: 112,689,376 N116S probably damaging Het
Sorcs2 C A 5: 36,024,566 probably null Het
Spink5 T C 18: 43,986,300 L226P probably damaging Het
Tab1 G A 15: 80,150,553 V180I probably benign Het
Tacc2 T G 7: 130,624,328 S914R probably damaging Het
Tacc2 C T 7: 130,624,479 R965C probably benign Het
Tlr9 A G 9: 106,224,773 D421G probably damaging Het
Tmem181a T C 17: 6,256,990 L16P probably damaging Het
Trim58 A T 11: 58,651,249 H345L probably damaging Het
Ttc13 G A 8: 124,673,551 R688C probably benign Het
Ube2o C A 11: 116,542,838 V685L probably damaging Het
Uso1 A G 5: 92,187,314 H511R probably benign Het
Vmn2r5 A T 3: 64,504,300 Y282* probably null Het
Other mutations in Lhfpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Lhfpl5 APN 17 28576175 missense possibly damaging 0.49
R0885:Lhfpl5 UTSW 17 28576037 missense probably damaging 1.00
R3176:Lhfpl5 UTSW 17 28579946 missense possibly damaging 0.87
R3276:Lhfpl5 UTSW 17 28579946 missense possibly damaging 0.87
R4747:Lhfpl5 UTSW 17 28579976 missense probably damaging 1.00
R4817:Lhfpl5 UTSW 17 28576326 missense possibly damaging 0.93
R4817:Lhfpl5 UTSW 17 28582988 makesense probably null
R5148:Lhfpl5 UTSW 17 28579968 missense probably damaging 1.00
R5447:Lhfpl5 UTSW 17 28576097 missense probably damaging 1.00
R7024:Lhfpl5 UTSW 17 28582983 missense probably benign 0.15
R7605:Lhfpl5 UTSW 17 28576331 missense possibly damaging 0.93
R9545:Lhfpl5 UTSW 17 28580105 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGGATGTCTAGTCTACCCAG -3'
(R):5'- CTGAATAGCCTGCCAGCTTTG -3'

Sequencing Primer
(F):5'- CAGATGGTTGGGACTCCAG -3'
(R):5'- TTGAACACTCCGCTGATGG -3'
Posted On 2022-02-07