Incidental Mutation 'R9221:Lhfpl5'
ID 699496
Institutional Source Beutler Lab
Gene Symbol Lhfpl5
Ensembl Gene ENSMUSG00000062252
Gene Name lipoma HMGIC fusion partner-like 5
Synonyms 9330179O15Rik, Tmhs
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.217) question?
Stock # R9221 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 28794330-28802567 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 28799133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 214 (D214V)
Ref Sequence ENSEMBL: ENSMUSP00000079598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080780]
AlphaFold Q4KL25
Predicted Effect possibly damaging
Transcript: ENSMUST00000080780
AA Change: D214V

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079598
Gene: ENSMUSG00000062252
AA Change: D214V

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 25 202 1.5e-67 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in this gene result in deafness in humans, and a mutation in a similar gene in mice results in deafness and vestibular dysfunction with severe degeneration of the organ of Corti. It is proposed to function in hair bundle morphogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in deafness and vestibular dysfunction with severe degeneration of the organ of Corti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 121,921,828 (GRCm39) D1128G probably damaging Het
Acsm3 A T 7: 119,368,131 (GRCm39) R116* probably null Het
Acte1 G T 7: 143,434,902 (GRCm39) probably null Het
Ahnak T A 19: 8,989,943 (GRCm39) D3742E probably damaging Het
Arhgef17 A G 7: 100,528,818 (GRCm39) S598P possibly damaging Het
Asxl2 T C 12: 3,552,310 (GRCm39) F1351L probably damaging Het
Atg7 C T 6: 114,672,588 (GRCm39) T267I possibly damaging Het
Bace2 A G 16: 97,209,692 (GRCm39) K202R probably benign Het
Bccip G T 7: 133,311,249 (GRCm39) V55L probably benign Het
Bpifa1 T A 2: 153,988,052 (GRCm39) H198Q possibly damaging Het
Btbd7 A G 12: 102,777,430 (GRCm39) Y466H probably damaging Het
Cdc45 A C 16: 18,605,521 (GRCm39) S480A probably benign Het
Cenpe T C 3: 134,935,839 (GRCm39) Y425H possibly damaging Het
Cep76 A C 18: 67,767,977 (GRCm39) M185R probably damaging Het
Chd5 G T 4: 152,456,122 (GRCm39) M930I probably damaging Het
Clstn2 G T 9: 97,343,395 (GRCm39) T684K probably benign Het
Col4a2 A G 8: 11,491,943 (GRCm39) N1270S possibly damaging Het
Crxos A G 7: 15,636,850 (GRCm39) H141R probably benign Het
Dcc A G 18: 71,553,433 (GRCm39) I741T possibly damaging Het
Ddx20 A T 3: 105,587,685 (GRCm39) C430* probably null Het
Dgki G A 6: 37,273,615 (GRCm39) T12M probably benign Het
Dock6 T C 9: 21,721,153 (GRCm39) N1676S possibly damaging Het
Exosc6 G A 8: 111,783,028 (GRCm39) R9H probably damaging Het
Fstl5 A G 3: 76,569,114 (GRCm39) Q589R probably damaging Het
Gm4846 T A 1: 166,324,959 (GRCm39) Y44F probably benign Het
Gpr15lg A G 14: 36,829,352 (GRCm39) S44P probably damaging Het
Gtf3c2 A C 5: 31,326,401 (GRCm39) I370R probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hspg2 A G 4: 137,287,726 (GRCm39) M3696V possibly damaging Het
Itga1 A T 13: 115,166,695 (GRCm39) C167* probably null Het
Khdc4 T C 3: 88,593,853 (GRCm39) S81P probably benign Het
Kpna2 A G 11: 106,880,158 (GRCm39) S497P probably damaging Het
Krt77 T A 15: 101,774,064 (GRCm39) T197S probably damaging Het
Krtap6-5 T C 16: 88,844,655 (GRCm39) Y26C unknown Het
Lrrtm1 A G 6: 77,221,596 (GRCm39) E351G probably damaging Het
Mphosph9 A G 5: 124,403,427 (GRCm39) V867A probably benign Het
Mtcl1 T A 17: 66,650,879 (GRCm39) M1529L probably benign Het
Mthfr A T 4: 148,132,626 (GRCm39) Q268L probably damaging Het
Myo1d A T 11: 80,565,744 (GRCm39) N360K probably damaging Het
Nbea AC A 3: 55,998,393 (GRCm39) probably null Het
Or1e33 A T 11: 73,738,108 (GRCm39) V281E probably damaging Het
Or4p8 T C 2: 88,727,255 (GRCm39) S229G probably benign Het
Or5an1b A T 19: 12,299,336 (GRCm39) M285K probably damaging Het
Or5m11 T A 2: 85,782,185 (GRCm39) Y259* probably null Het
P2rx5 A T 11: 73,062,655 (GRCm39) T455S probably damaging Het
Palld A T 8: 61,969,591 (GRCm39) F1244L unknown Het
Pbld1 A G 10: 62,907,829 (GRCm39) T125A Het
Pde3b G A 7: 114,014,697 (GRCm39) probably benign Het
Pfkm T C 15: 98,019,188 (GRCm39) S180P probably damaging Het
Pla2g4d T A 2: 120,100,453 (GRCm39) R626S possibly damaging Het
Postn A G 3: 54,282,515 (GRCm39) E492G possibly damaging Het
Prph2 A G 17: 47,230,818 (GRCm39) D237G probably damaging Het
Psmd4 T C 3: 94,942,604 (GRCm39) H105R probably damaging Het
Pygl T C 12: 70,242,401 (GRCm39) N685S probably damaging Het
Rp1 A G 1: 4,315,266 (GRCm39) F502S unknown Het
Sik1 T C 17: 32,066,167 (GRCm39) I607V probably benign Het
Slc26a3 T A 12: 31,513,470 (GRCm39) I464N possibly damaging Het
Slc38a9 A G 13: 112,825,910 (GRCm39) N116S probably damaging Het
Sorcs2 C A 5: 36,181,910 (GRCm39) probably null Het
Spink5 T C 18: 44,119,367 (GRCm39) L226P probably damaging Het
Tab1 G A 15: 80,034,754 (GRCm39) V180I probably benign Het
Tacc2 C T 7: 130,226,209 (GRCm39) R965C probably benign Het
Tacc2 T G 7: 130,226,058 (GRCm39) S914R probably damaging Het
Tlr9 A G 9: 106,101,972 (GRCm39) D421G probably damaging Het
Tmem181a T C 17: 6,307,265 (GRCm39) L16P probably damaging Het
Trim58 A T 11: 58,542,075 (GRCm39) H345L probably damaging Het
Ttc13 G A 8: 125,400,290 (GRCm39) R688C probably benign Het
Ube2o C A 11: 116,433,664 (GRCm39) V685L probably damaging Het
Uso1 A G 5: 92,335,173 (GRCm39) H511R probably benign Het
Vmn2r5 A T 3: 64,411,721 (GRCm39) Y282* probably null Het
Other mutations in Lhfpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Lhfpl5 APN 17 28,795,149 (GRCm39) missense possibly damaging 0.49
R0885:Lhfpl5 UTSW 17 28,795,011 (GRCm39) missense probably damaging 1.00
R3176:Lhfpl5 UTSW 17 28,798,920 (GRCm39) missense possibly damaging 0.87
R3276:Lhfpl5 UTSW 17 28,798,920 (GRCm39) missense possibly damaging 0.87
R4747:Lhfpl5 UTSW 17 28,798,950 (GRCm39) missense probably damaging 1.00
R4817:Lhfpl5 UTSW 17 28,801,962 (GRCm39) makesense probably null
R4817:Lhfpl5 UTSW 17 28,795,300 (GRCm39) missense possibly damaging 0.93
R5148:Lhfpl5 UTSW 17 28,798,942 (GRCm39) missense probably damaging 1.00
R5447:Lhfpl5 UTSW 17 28,795,071 (GRCm39) missense probably damaging 1.00
R7024:Lhfpl5 UTSW 17 28,801,957 (GRCm39) missense probably benign 0.15
R7605:Lhfpl5 UTSW 17 28,795,305 (GRCm39) missense possibly damaging 0.93
R9545:Lhfpl5 UTSW 17 28,799,079 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGGATGTCTAGTCTACCCAG -3'
(R):5'- CTGAATAGCCTGCCAGCTTTG -3'

Sequencing Primer
(F):5'- CAGATGGTTGGGACTCCAG -3'
(R):5'- TTGAACACTCCGCTGATGG -3'
Posted On 2022-02-07