Incidental Mutation 'R9222:Scn11a'
ID 699546
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R9222 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 119753759-119825456 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119781947 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 946 (V946E)
Ref Sequence ENSEMBL: ENSMUSP00000065466 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: V946E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: V946E

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: V946E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik C A 5: 138,562,300 V278F unknown Het
Actr5 T A 2: 158,631,503 N272K probably damaging Het
Afg3l2 T C 18: 67,434,187 T198A probably benign Het
Aloxe3 A G 11: 69,133,077 Y278C probably damaging Het
Apobec3 A G 15: 79,899,069 I226V Het
Arap2 T A 5: 62,671,078 T917S possibly damaging Het
Arhgap40 T C 2: 158,546,772 L545P probably damaging Het
Atp13a5 A T 16: 29,314,654 L438H probably damaging Het
Atp5s T C 12: 69,741,780 V151A probably damaging Het
BC051142 A T 17: 34,429,948 I43L Het
Ccdc191 T A 16: 43,905,468 Y105N probably damaging Het
Ccdc7a A T 8: 128,799,129 F1406L unknown Het
Celsr1 A G 15: 85,931,270 V1848A possibly damaging Het
Chn1 T A 2: 73,613,155 N417I probably damaging Het
Cmya5 T C 13: 93,094,071 K1503R probably benign Het
Cryz T C 3: 154,611,566 F141L probably benign Het
Dpep2 T A 8: 105,996,384 H13L Het
Eif2b5 C T 16: 20,502,632 R312* probably null Het
Evc A T 5: 37,320,306 M343K probably benign Het
Fbxw17 T A 13: 50,423,331 D86E probably damaging Het
Fbxw9 T A 8: 85,062,227 L202Q probably damaging Het
Fkbp9 G T 6: 56,875,692 V466F probably damaging Het
Fras1 G A 5: 96,657,228 R1243Q probably benign Het
Fsip2 C T 2: 82,985,614 T3897I probably benign Het
Fut7 T C 2: 25,425,179 S150P possibly damaging Het
Gm498 G T 7: 143,881,165 probably null Het
Gstm5 A G 3: 107,897,318 I73V probably benign Het
Hspb9 A G 11: 100,713,943 M32V possibly damaging Het
Ift80 A G 3: 68,918,561 I482T possibly damaging Het
Khk C T 5: 30,921,797 probably benign Het
Kmt2d A T 15: 98,849,443 H3333Q unknown Het
Lamc1 G T 1: 153,243,341 T844K probably damaging Het
Luc7l2 A T 6: 38,565,698 I10L probably benign Het
Mosmo T A 7: 120,677,832 I23N probably benign Het
Nbea AC A 3: 56,090,972 probably null Het
Nfkbiz A T 16: 55,813,984 V700E probably damaging Het
Nsun7 T C 5: 66,261,023 V32A probably benign Het
Olfr142 C T 2: 90,252,476 V171M possibly damaging Het
Oog1 A G 12: 87,606,246 D104G probably damaging Het
Pde3a A G 6: 141,492,178 D991G probably damaging Het
Pds5a G A 5: 65,647,938 H522Y probably benign Het
Pi4ka A G 16: 17,358,361 S405P Het
Plk4 T A 3: 40,806,555 V440E possibly damaging Het
Prkd2 A G 7: 16,843,774 I51V probably damaging Het
Ptprt T C 2: 161,560,186 T1042A probably damaging Het
Rsph6a C A 7: 19,068,061 T600N possibly damaging Het
Sec11a G A 7: 80,915,886 L170F probably damaging Het
Slc15a5 A G 6: 137,984,452 I215T Het
Slc1a1 A G 19: 28,905,394 I353V probably benign Het
Smox A G 2: 131,520,923 E374G possibly damaging Het
Soga1 A G 2: 157,039,999 V711A probably benign Het
Sytl2 A G 7: 90,401,425 T727A possibly damaging Het
Taar7d A C 10: 24,028,226 K335N probably benign Het
Tacc2 T A 7: 130,626,255 S1557T probably benign Het
Tbx19 C A 1: 165,139,040 V422L probably benign Het
Tdrd1 G T 19: 56,843,247 V357F probably benign Het
Tdrd6 A G 17: 43,628,340 C606R probably damaging Het
Tmcc1 C G 6: 116,043,088 G468R Het
Tmem209 G A 6: 30,506,839 T93I probably damaging Het
Trpv1 T C 11: 73,250,855 V568A possibly damaging Het
Tubgcp2 T C 7: 140,008,052 D220G probably damaging Het
Vmn1r11 A G 6: 57,138,007 R219G possibly damaging Het
Zan A G 5: 137,467,201 S431P possibly damaging Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119770506 missense probably benign 0.00
IGL00272:Scn11a APN 9 119816603 missense probably damaging 0.98
IGL00332:Scn11a APN 9 119769916 missense probably damaging 1.00
IGL00533:Scn11a APN 9 119774381 missense probably damaging 1.00
IGL00972:Scn11a APN 9 119793938 missense probably benign 0.44
IGL01338:Scn11a APN 9 119784161 splice site probably benign
IGL01534:Scn11a APN 9 119780822 missense probably benign 0.27
IGL01838:Scn11a APN 9 119758583 missense probably damaging 1.00
IGL01991:Scn11a APN 9 119819904 missense probably damaging 0.97
IGL02057:Scn11a APN 9 119765470 missense probably damaging 1.00
IGL02290:Scn11a APN 9 119774442 missense probably damaging 0.97
IGL02454:Scn11a APN 9 119758544 missense probably benign 0.00
IGL02517:Scn11a APN 9 119792398 missense probably damaging 1.00
IGL02567:Scn11a APN 9 119804489 missense probably damaging 0.99
IGL02587:Scn11a APN 9 119805684 missense probably damaging 1.00
IGL03069:Scn11a APN 9 119789963 missense probably benign 0.16
IGL03171:Scn11a APN 9 119819847 missense probably benign 0.00
Kleinie UTSW 9 119803503 missense probably benign 0.16
H8441:Scn11a UTSW 9 119807910 missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119769948 missense probably damaging 1.00
R0304:Scn11a UTSW 9 119819862 missense probably benign 0.00
R0519:Scn11a UTSW 9 119790119 missense probably damaging 1.00
R0658:Scn11a UTSW 9 119811160 missense probably benign 0.41
R0828:Scn11a UTSW 9 119755007 missense probably benign 0.00
R0893:Scn11a UTSW 9 119803330 splice site probably null
R0932:Scn11a UTSW 9 119807810 missense probably damaging 1.00
R1061:Scn11a UTSW 9 119795663 missense probably damaging 0.98
R1161:Scn11a UTSW 9 119755057 nonsense probably null
R1162:Scn11a UTSW 9 119805644 splice site probably benign
R1310:Scn11a UTSW 9 119755057 nonsense probably null
R1589:Scn11a UTSW 9 119769807 missense probably damaging 1.00
R1681:Scn11a UTSW 9 119804412 missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119755082 missense probably damaging 1.00
R1812:Scn11a UTSW 9 119780865 nonsense probably null
R1901:Scn11a UTSW 9 119779036 nonsense probably null
R1978:Scn11a UTSW 9 119780795 nonsense probably null
R1985:Scn11a UTSW 9 119754678 missense probably benign 0.19
R2022:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119811208 missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119792494 missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119755025 missense probably damaging 1.00
R2250:Scn11a UTSW 9 119758602 missense probably benign 0.01
R2373:Scn11a UTSW 9 119813186 missense probably benign 0.43
R2508:Scn11a UTSW 9 119765529 missense probably damaging 1.00
R3757:Scn11a UTSW 9 119803503 missense probably benign 0.16
R3767:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R3770:Scn11a UTSW 9 119784049 missense probably damaging 1.00
R4089:Scn11a UTSW 9 119795653 splice site probably null
R4092:Scn11a UTSW 9 119789970 missense probably benign 0.03
R4247:Scn11a UTSW 9 119807886 missense probably damaging 1.00
R4279:Scn11a UTSW 9 119754362 missense probably benign 0.25
R4299:Scn11a UTSW 9 119765506 missense probably damaging 0.97
R4403:Scn11a UTSW 9 119795667 missense probably damaging 1.00
R4468:Scn11a UTSW 9 119754987 missense probably damaging 1.00
R4542:Scn11a UTSW 9 119755134 missense probably damaging 1.00
R4644:Scn11a UTSW 9 119815203 splice site probably null
R4739:Scn11a UTSW 9 119754561 missense probably benign 0.39
R4809:Scn11a UTSW 9 119819870 missense probably benign 0.00
R4954:Scn11a UTSW 9 119758659 missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119780878 missense probably benign 0.31
R5044:Scn11a UTSW 9 119819831 missense probably damaging 0.98
R5222:Scn11a UTSW 9 119815202 splice site probably null
R5224:Scn11a UTSW 9 119754792 missense probably damaging 1.00
R5400:Scn11a UTSW 9 119769908 missense probably damaging 0.97
R5555:Scn11a UTSW 9 119755238 missense probably damaging 1.00
R5711:Scn11a UTSW 9 119789924 missense probably damaging 1.00
R5950:Scn11a UTSW 9 119811124 missense probably damaging 1.00
R5984:Scn11a UTSW 9 119784016 missense probably benign
R6057:Scn11a UTSW 9 119765448 missense probably damaging 1.00
R6104:Scn11a UTSW 9 119795678 missense probably damaging 1.00
R6180:Scn11a UTSW 9 119754867 missense probably benign 0.00
R6892:Scn11a UTSW 9 119806969 missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119792426 missense probably damaging 1.00
R6949:Scn11a UTSW 9 119765514 missense probably benign 0.04
R7112:Scn11a UTSW 9 119754809 missense probably damaging 1.00
R7232:Scn11a UTSW 9 119759916 missense probably damaging 1.00
R7261:Scn11a UTSW 9 119819833 missense probably damaging 0.99
R7265:Scn11a UTSW 9 119815265 missense probably damaging 1.00
R7302:Scn11a UTSW 9 119806951 missense probably benign 0.03
R7391:Scn11a UTSW 9 119795717 missense probably damaging 1.00
R7441:Scn11a UTSW 9 119758626 missense probably benign 0.01
R7479:Scn11a UTSW 9 119759875 missense probably benign 0.38
R7608:Scn11a UTSW 9 119815313 splice site probably null
R7768:Scn11a UTSW 9 119815272 missense probably benign 0.13
R7785:Scn11a UTSW 9 119816556 missense probably benign 0.00
R7794:Scn11a UTSW 9 119765514 missense probably damaging 0.99
R7818:Scn11a UTSW 9 119784111 missense probably damaging 0.97
R7884:Scn11a UTSW 9 119804551 missense probably benign 0.01
R7988:Scn11a UTSW 9 119765437 missense probably damaging 0.97
R8049:Scn11a UTSW 9 119755083 missense probably damaging 1.00
R8127:Scn11a UTSW 9 119804512 missense probably damaging 1.00
R8274:Scn11a UTSW 9 119803482 missense probably benign
R8344:Scn11a UTSW 9 119781970 missense probably benign 0.00
R8346:Scn11a UTSW 9 119778981 missense probably damaging 1.00
R8511:Scn11a UTSW 9 119789915 missense probably damaging 0.99
R8819:Scn11a UTSW 9 119816520 missense probably benign 0.19
R8820:Scn11a UTSW 9 119816520 missense probably benign 0.19
R8837:Scn11a UTSW 9 119792344 missense probably damaging 1.00
R8913:Scn11a UTSW 9 119794028 missense probably damaging 1.00
R8915:Scn11a UTSW 9 119774297 nonsense probably null
R8975:Scn11a UTSW 9 119758499 missense probably damaging 1.00
R9156:Scn11a UTSW 9 119759923 missense possibly damaging 0.75
R9355:Scn11a UTSW 9 119755094 missense probably damaging 1.00
R9486:Scn11a UTSW 9 119795708 missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119790010 nonsense probably null
R9766:Scn11a UTSW 9 119755115 missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119755242 missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119754998 missense possibly damaging 0.94
Z1177:Scn11a UTSW 9 119819820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACACTTGTTTAAGAATCTACCC -3'
(R):5'- AGGAACTTGACAATGCATTCCTCTTC -3'

Sequencing Primer
(F):5'- AGAATCTACCCTGGCAATCATTTC -3'
(R):5'- GTTCTAGCCAGTATTTTTCCCAG -3'
Posted On 2022-02-07