Incidental Mutation 'R9222:Afg3l2'
ID 699565
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene Name AFG3-like AAA ATPase 2
Synonyms 2310036I02Rik, Emv66, par
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9222 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 67404767-67449166 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67434187 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 198 (T198A)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
AlphaFold Q8JZQ2
Predicted Effect probably benign
Transcript: ENSMUST00000025408
AA Change: T198A

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: T198A

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik C A 5: 138,562,300 V278F unknown Het
Actr5 T A 2: 158,631,503 N272K probably damaging Het
Aloxe3 A G 11: 69,133,077 Y278C probably damaging Het
Apobec3 A G 15: 79,899,069 I226V Het
Arap2 T A 5: 62,671,078 T917S possibly damaging Het
Arhgap40 T C 2: 158,546,772 L545P probably damaging Het
Atp13a5 A T 16: 29,314,654 L438H probably damaging Het
Atp5s T C 12: 69,741,780 V151A probably damaging Het
BC051142 A T 17: 34,429,948 I43L Het
Ccdc191 T A 16: 43,905,468 Y105N probably damaging Het
Ccdc7a A T 8: 128,799,129 F1406L unknown Het
Celsr1 A G 15: 85,931,270 V1848A possibly damaging Het
Chn1 T A 2: 73,613,155 N417I probably damaging Het
Cmya5 T C 13: 93,094,071 K1503R probably benign Het
Cryz T C 3: 154,611,566 F141L probably benign Het
Dpep2 T A 8: 105,996,384 H13L Het
Eif2b5 C T 16: 20,502,632 R312* probably null Het
Evc A T 5: 37,320,306 M343K probably benign Het
Fbxw17 T A 13: 50,423,331 D86E probably damaging Het
Fbxw9 T A 8: 85,062,227 L202Q probably damaging Het
Fkbp9 G T 6: 56,875,692 V466F probably damaging Het
Fras1 G A 5: 96,657,228 R1243Q probably benign Het
Fsip2 C T 2: 82,985,614 T3897I probably benign Het
Fut7 T C 2: 25,425,179 S150P possibly damaging Het
Gm498 G T 7: 143,881,165 probably null Het
Gstm5 A G 3: 107,897,318 I73V probably benign Het
Hspb9 A G 11: 100,713,943 M32V possibly damaging Het
Ift80 A G 3: 68,918,561 I482T possibly damaging Het
Khk C T 5: 30,921,797 probably benign Het
Kmt2d A T 15: 98,849,443 H3333Q unknown Het
Lamc1 G T 1: 153,243,341 T844K probably damaging Het
Mosmo T A 7: 120,677,832 I23N probably benign Het
Nbea AC A 3: 56,090,972 probably null Het
Nfkbiz A T 16: 55,813,984 V700E probably damaging Het
Nsun7 T C 5: 66,261,023 V32A probably benign Het
Olfr142 C T 2: 90,252,476 V171M possibly damaging Het
Oog1 A G 12: 87,606,246 D104G probably damaging Het
Pde3a A G 6: 141,492,178 D991G probably damaging Het
Pds5a G A 5: 65,647,938 H522Y probably benign Het
Pi4ka A G 16: 17,358,361 S405P Het
Plk4 T A 3: 40,806,555 V440E possibly damaging Het
Prkd2 A G 7: 16,843,774 I51V probably damaging Het
Ptprt T C 2: 161,560,186 T1042A probably damaging Het
Rsph6a C A 7: 19,068,061 T600N possibly damaging Het
Scn11a A T 9: 119,781,947 V946E probably damaging Het
Sec11a G A 7: 80,915,886 L170F probably damaging Het
Slc15a5 A G 6: 137,984,452 I215T Het
Slc1a1 A G 19: 28,905,394 I353V probably benign Het
Smox A G 2: 131,520,923 E374G possibly damaging Het
Soga1 A G 2: 157,039,999 V711A probably benign Het
Sytl2 A G 7: 90,401,425 T727A possibly damaging Het
Taar7d A C 10: 24,028,226 K335N probably benign Het
Tacc2 T A 7: 130,626,255 S1557T probably benign Het
Tbx19 C A 1: 165,139,040 V422L probably benign Het
Tdrd1 G T 19: 56,843,247 V357F probably benign Het
Tdrd6 A G 17: 43,628,340 C606R probably damaging Het
Tmcc1 C G 6: 116,043,088 G468R Het
Tmem209 G A 6: 30,506,839 T93I probably damaging Het
Trpv1 T C 11: 73,250,855 V568A possibly damaging Het
Tubgcp2 T C 7: 140,008,052 D220G probably damaging Het
Vmn1r11 A G 6: 57,138,007 R219G possibly damaging Het
Zan A G 5: 137,467,201 S431P possibly damaging Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
R8479:Afg3l2 UTSW 18 67448916 missense probably benign 0.05
R8531:Afg3l2 UTSW 18 67407369 missense probably damaging 0.99
R9017:Afg3l2 UTSW 18 67409480 missense possibly damaging 0.81
R9220:Afg3l2 UTSW 18 67429196 missense probably benign
R9371:Afg3l2 UTSW 18 67434192 missense possibly damaging 0.84
R9381:Afg3l2 UTSW 18 67442381 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GAAGCCTTTCCACACAGCAG -3'
(R):5'- ACCTGGATGACTGGCTGTAGAG -3'

Sequencing Primer
(F):5'- AGCAGCTGGTGTCAGTGC -3'
(R):5'- ATGACTGGCTGTAGAGACTGG -3'
Posted On 2022-02-07