Incidental Mutation 'R9223:Col20a1'
ID 699580
Institutional Source Beutler Lab
Gene Symbol Col20a1
Ensembl Gene ENSMUSG00000016356
Gene Name collagen, type XX, alpha 1
Synonyms 1700051I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 180986535-181018363 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 181006735 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 938 (E938D)
Ref Sequence ENSEMBL: ENSMUSP00000104484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108856] [ENSMUST00000149179] [ENSMUST00000228434]
AlphaFold Q923P0
Predicted Effect probably damaging
Transcript: ENSMUST00000108856
AA Change: E938D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104484
Gene: ENSMUSG00000016356
AA Change: E938D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
Pfam:Collagen 1067 1125 3.8e-9 PFAM
Pfam:Collagen 1122 1174 7.4e-9 PFAM
Pfam:Collagen 1165 1223 3e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149179
AA Change: E896D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115291
Gene: ENSMUSG00000016356
AA Change: E896D

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 24 103 2.18e1 SMART
VWA 175 354 4.68e-55 SMART
FN3 375 453 6.2e-7 SMART
FN3 464 543 7.34e-9 SMART
FN3 555 633 8.18e-7 SMART
FN3 644 723 8.98e-4 SMART
FN3 738 817 1.43e-11 SMART
TSPN 840 1035 6.45e-31 SMART
low complexity region 1069 1106 N/A INTRINSIC
low complexity region 1108 1121 N/A INTRINSIC
low complexity region 1136 1155 N/A INTRINSIC
Blast:TSPN 1156 1202 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152473
Predicted Effect probably damaging
Transcript: ENSMUST00000228434
AA Change: E896D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik C A 9: 101,942,994 D204E possibly damaging Het
Aldh3a2 A G 11: 61,265,211 S80P probably benign Het
Bcl6b A T 11: 70,226,574 Y407* probably null Het
Cel TTA TTATA 2: 28,559,429 probably null Het
Cerkl A T 2: 79,341,330 C395S probably damaging Het
Chst5 C A 8: 111,890,860 V43L probably benign Het
Clip1 A T 5: 123,646,274 F271I probably damaging Het
Clspn A G 4: 126,590,618 T1190A possibly damaging Het
Ctgf T C 10: 24,595,958 V49A probably benign Het
Dmrta2 G A 4: 109,982,582 V509M probably damaging Het
Dnah7b T A 1: 46,322,260 M3440K probably benign Het
Erlin1 A G 19: 44,040,745 probably null Het
Fam24b A G 7: 131,326,140 S107P probably benign Het
Fancm T A 12: 65,102,584 I708N probably benign Het
Fbxo11 A T 17: 88,015,696 D12E Het
Fbxw13 T C 9: 109,195,048 D39G probably damaging Het
Gabrb3 T G 7: 57,816,404 L322R probably damaging Het
Gm10696 A C 3: 94,175,643 L287R probably damaging Het
Gm5239 A T 18: 35,536,619 I13F possibly damaging Het
Heatr1 A G 13: 12,404,921 Y375C probably benign Het
Helq A T 5: 100,798,437 S13T possibly damaging Het
Helz A G 11: 107,619,092 T514A probably benign Het
Hook3 A G 8: 26,032,524 V32A Het
Htra4 A G 8: 25,037,032 I249T possibly damaging Het
Htt G T 5: 34,905,348 V2809L probably benign Het
Ifi203 T A 1: 173,937,871 I46F probably benign Het
Kcna2 A T 3: 107,104,990 I296F possibly damaging Het
Kndc1 A G 7: 139,921,441 E882G possibly damaging Het
Krtap16-1 A T 11: 99,985,245 D444E probably benign Het
Lrrtm3 ATTTT ATTTTT 10: 64,089,256 probably null Het
Mdga2 C T 12: 66,568,860 D658N possibly damaging Het
Mkrn1 T C 6: 39,401,249 K316R possibly damaging Het
Mmd2 C T 5: 142,567,911 C165Y probably damaging Het
Mpdz A G 4: 81,284,630 F1843L probably damaging Het
Mrc2 G A 11: 105,329,267 R338Q probably damaging Het
Naip5 C T 13: 100,227,676 R372H probably benign Het
Nav2 C A 7: 49,552,851 S1461Y probably damaging Het
Nol8 T A 13: 49,661,262 V282D possibly damaging Het
Nup98 C A 7: 102,184,960 G265V possibly damaging Het
Olfr1049 G T 2: 86,255,200 F164L possibly damaging Het
Olfr1311 T A 2: 112,021,172 K227N possibly damaging Het
Olfr1318 T A 2: 112,156,128 M59K possibly damaging Het
Olfr132 C T 17: 38,131,121 E24K possibly damaging Het
Olfr1532-ps1 A G 7: 106,914,773 T192A possibly damaging Het
Olfr356 T C 2: 36,937,899 F260S probably damaging Het
Otogl T A 10: 107,854,344 E888D probably damaging Het
Pcdhgc4 A G 18: 37,815,632 I34V possibly damaging Het
Ppp1r12b T C 1: 134,879,638 R417G probably benign Het
Rtn4 A G 11: 29,706,778 S311G probably benign Het
Serinc3 A G 2: 163,636,892 V105A probably benign Het
Serpina3f A G 12: 104,217,185 D102G possibly damaging Het
Sik3 A G 9: 46,155,474 I184V probably damaging Het
Tex35 A T 1: 157,107,866 C21S probably benign Het
Tfap2b T C 1: 19,212,425 probably null Het
Thbs4 C T 13: 92,761,490 C607Y probably damaging Het
Tmem144 A T 3: 79,827,657 N151K probably benign Het
Tomm70a T A 16: 57,142,803 M395K probably benign Het
Trim43b A C 9: 89,085,610 H324Q probably benign Het
Vmn2r116 A T 17: 23,401,167 Y625F probably damaging Het
Yipf3 A T 17: 46,248,872 N38I probably damaging Het
Zfp804b T A 5: 6,771,496 E522D probably benign Het
Other mutations in Col20a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Col20a1 APN 2 181003479 missense possibly damaging 0.93
IGL00975:Col20a1 APN 2 180992478 missense probably damaging 1.00
IGL01094:Col20a1 APN 2 180999766 missense probably damaging 0.99
IGL01388:Col20a1 APN 2 181003471 missense probably benign 0.24
IGL01472:Col20a1 APN 2 181007832 missense probably benign 0.44
IGL01936:Col20a1 APN 2 181009368 splice site probably benign
IGL02133:Col20a1 APN 2 181007144 missense probably damaging 1.00
IGL02318:Col20a1 APN 2 181007159 missense probably damaging 0.99
IGL02576:Col20a1 APN 2 181013405 nonsense probably null
IGL02822:Col20a1 APN 2 180996807 missense probably damaging 1.00
IGL02898:Col20a1 APN 2 180989112 nonsense probably null
IGL03056:Col20a1 APN 2 180994889 missense probably damaging 1.00
IGL03189:Col20a1 APN 2 181009407 nonsense probably null
IGL03196:Col20a1 APN 2 181007878 splice site probably null
R0001:Col20a1 UTSW 2 180984412 unclassified probably benign
R0200:Col20a1 UTSW 2 181000438 missense probably damaging 1.00
R0384:Col20a1 UTSW 2 180999162 missense probably benign 0.00
R0964:Col20a1 UTSW 2 180984485 unclassified probably benign
R0975:Col20a1 UTSW 2 181006826 missense possibly damaging 0.75
R1359:Col20a1 UTSW 2 180999792 missense probably benign 0.02
R1395:Col20a1 UTSW 2 180998607 missense probably damaging 0.99
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1470:Col20a1 UTSW 2 180994960 missense probably benign 0.01
R1508:Col20a1 UTSW 2 180992577 missense probably damaging 0.98
R1865:Col20a1 UTSW 2 181015813 missense possibly damaging 0.87
R1883:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1884:Col20a1 UTSW 2 180992910 missense possibly damaging 0.52
R1906:Col20a1 UTSW 2 180998697 missense probably benign 0.00
R2020:Col20a1 UTSW 2 181013163 critical splice donor site probably null
R2121:Col20a1 UTSW 2 180996456 missense probably damaging 0.99
R2131:Col20a1 UTSW 2 180992573 missense probably damaging 1.00
R2343:Col20a1 UTSW 2 181001331 missense possibly damaging 0.73
R3153:Col20a1 UTSW 2 181008593 missense probably damaging 1.00
R3430:Col20a1 UTSW 2 181013285 nonsense probably null
R3547:Col20a1 UTSW 2 180994911 missense probably damaging 1.00
R3844:Col20a1 UTSW 2 180992449 missense probably damaging 1.00
R3914:Col20a1 UTSW 2 180998492 missense probably benign 0.00
R4414:Col20a1 UTSW 2 181001250 missense possibly damaging 0.92
R4711:Col20a1 UTSW 2 180992491 missense probably damaging 1.00
R4760:Col20a1 UTSW 2 180984403 unclassified probably benign
R4771:Col20a1 UTSW 2 180989124 missense probably benign 0.17
R4809:Col20a1 UTSW 2 180998661 missense probably damaging 1.00
R4872:Col20a1 UTSW 2 180997363 missense possibly damaging 0.74
R5045:Col20a1 UTSW 2 181006845 missense probably damaging 1.00
R5238:Col20a1 UTSW 2 180998586 missense probably damaging 1.00
R5566:Col20a1 UTSW 2 180986523 splice site probably null
R6389:Col20a1 UTSW 2 180992583 splice site probably null
R6422:Col20a1 UTSW 2 181014819 missense possibly damaging 0.75
R6924:Col20a1 UTSW 2 180996850 missense probably damaging 1.00
R6982:Col20a1 UTSW 2 180996706 missense probably benign 0.00
R7177:Col20a1 UTSW 2 180994214 nonsense probably null
R7195:Col20a1 UTSW 2 181007231 missense probably damaging 1.00
R7717:Col20a1 UTSW 2 181007615 missense probably damaging 1.00
R7872:Col20a1 UTSW 2 180986578 missense probably benign 0.14
R8183:Col20a1 UTSW 2 180998414 missense
R8188:Col20a1 UTSW 2 181016333 critical splice donor site probably null
R8331:Col20a1 UTSW 2 180996766 missense possibly damaging 0.95
R8423:Col20a1 UTSW 2 180998705 missense probably damaging 1.00
R8803:Col20a1 UTSW 2 181001338 missense possibly damaging 0.75
R8849:Col20a1 UTSW 2 180998639 missense probably damaging 1.00
R8855:Col20a1 UTSW 2 181013891 missense
R8885:Col20a1 UTSW 2 180998503 splice site probably benign
R9160:Col20a1 UTSW 2 180999745 missense probably benign
R9697:Col20a1 UTSW 2 180999784 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTGGCCTCCATTGTTG -3'
(R):5'- ATCCTTGGACTCGTGTTCCATG -3'

Sequencing Primer
(F):5'- CCTGGCTTCAGAGAGCAGAG -3'
(R):5'- CTCGTGTTCCATGAGGTTAAGAAAG -3'
Posted On 2022-02-07