Mutagenetix > Incidental Mutation

Incidental Mutation 'R9223:Clspn'

699586

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

068959-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126590618 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1190 (T1190A)

Ref Sequence

ENSEMBL: ENSMUSP00000045344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391]

AlphaFold

Q80YR7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048391
AA Change: T1190A

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: T1190A

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9630041A04Rik	C	A	9: 101,942,994	D204E	possibly damaging	Het
Aldh3a2	A	G	11: 61,265,211	S80P	probably benign	Het
Bcl6b	A	T	11: 70,226,574	Y407*	probably null	Het
Cel	TTA	TTATA	2: 28,559,429		probably null	Het
Cerkl	A	T	2: 79,341,330	C395S	probably damaging	Het
Chst5	C	A	8: 111,890,860	V43L	probably benign	Het
Clip1	A	T	5: 123,646,274	F271I	probably damaging	Het
Col20a1	A	T	2: 181,006,735	E938D	probably damaging	Het
Ctgf	T	C	10: 24,595,958	V49A	probably benign	Het
Dmrta2	G	A	4: 109,982,582	V509M	probably damaging	Het
Dnah7b	T	A	1: 46,322,260	M3440K	probably benign	Het
Erlin1	A	G	19: 44,040,745		probably null	Het
Fam24b	A	G	7: 131,326,140	S107P	probably benign	Het
Fancm	T	A	12: 65,102,584	I708N	probably benign	Het
Fbxo11	A	T	17: 88,015,696	D12E		Het
Fbxw13	T	C	9: 109,195,048	D39G	probably damaging	Het
Gabrb3	T	G	7: 57,816,404	L322R	probably damaging	Het
Gm10696	A	C	3: 94,175,643	L287R	probably damaging	Het
Gm5239	A	T	18: 35,536,619	I13F	possibly damaging	Het
Heatr1	A	G	13: 12,404,921	Y375C	probably benign	Het
Helq	A	T	5: 100,798,437	S13T	possibly damaging	Het
Helz	A	G	11: 107,619,092	T514A	probably benign	Het
Hook3	A	G	8: 26,032,524	V32A		Het
Htra4	A	G	8: 25,037,032	I249T	possibly damaging	Het
Htt	G	T	5: 34,905,348	V2809L	probably benign	Het
Ifi203	T	A	1: 173,937,871	I46F	probably benign	Het
Kcna2	A	T	3: 107,104,990	I296F	possibly damaging	Het
Kndc1	A	G	7: 139,921,441	E882G	possibly damaging	Het
Krtap16-1	A	T	11: 99,985,245	D444E	probably benign	Het
Lrrtm3	ATTTT	ATTTTT	10: 64,089,256		probably null	Het
Mdga2	C	T	12: 66,568,860	D658N	possibly damaging	Het
Mkrn1	T	C	6: 39,401,249	K316R	possibly damaging	Het
Mmd2	C	T	5: 142,567,911	C165Y	probably damaging	Het
Mpdz	A	G	4: 81,284,630	F1843L	probably damaging	Het
Mrc2	G	A	11: 105,329,267	R338Q	probably damaging	Het
Naip5	C	T	13: 100,227,676	R372H	probably benign	Het
Nav2	C	A	7: 49,552,851	S1461Y	probably damaging	Het
Nol8	T	A	13: 49,661,262	V282D	possibly damaging	Het
Nup98	C	A	7: 102,184,960	G265V	possibly damaging	Het
Olfr1049	G	T	2: 86,255,200	F164L	possibly damaging	Het
Olfr1311	T	A	2: 112,021,172	K227N	possibly damaging	Het
Olfr1318	T	A	2: 112,156,128	M59K	possibly damaging	Het
Olfr132	C	T	17: 38,131,121	E24K	possibly damaging	Het
Olfr1532-ps1	A	G	7: 106,914,773	T192A	possibly damaging	Het
Olfr356	T	C	2: 36,937,899	F260S	probably damaging	Het
Otogl	T	A	10: 107,854,344	E888D	probably damaging	Het
Pcdhgc4	A	G	18: 37,815,632	I34V	possibly damaging	Het
Ppp1r12b	T	C	1: 134,879,638	R417G	probably benign	Het
Rtn4	A	G	11: 29,706,778	S311G	probably benign	Het
Serinc3	A	G	2: 163,636,892	V105A	probably benign	Het
Serpina3f	A	G	12: 104,217,185	D102G	possibly damaging	Het
Sik3	A	G	9: 46,155,474	I184V	probably damaging	Het
Tex35	A	T	1: 157,107,866	C21S	probably benign	Het
Tfap2b	T	C	1: 19,212,425		probably null	Het
Thbs4	C	T	13: 92,761,490	C607Y	probably damaging	Het
Tmem144	A	T	3: 79,827,657	N151K	probably benign	Het
Tomm70a	T	A	16: 57,142,803	M395K	probably benign	Het
Trim43b	A	C	9: 89,085,610	H324Q	probably benign	Het
Vmn2r116	A	T	17: 23,401,167	Y625F	probably damaging	Het
Yipf3	A	T	17: 46,248,872	N38I	probably damaging	Het
Zfp804b	T	A	5: 6,771,496	E522D	probably benign	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7376:Clspn	UTSW	4	126590637	missense	possibly damaging	0.65
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTGAAGGTAATGTAATGTTGCATG -3'
(R):5'- TAAGAGACAACGTCTGCCTCTCC -3'

Sequencing Primer
(F):5'- CAGAGGCTGGTCTCTCATTATG -3'
(R):5'- CTCACCTCAATGGCTCCTTTAAGAC -3'

Posted On

2022-02-07