Incidental Mutation 'R9223:Clspn'
ID 699586
Institutional Source Beutler Lab
Gene Symbol Clspn
Ensembl Gene ENSMUSG00000042489
Gene Name claspin
Synonyms C85083, E130314M08Rik
MMRRC Submission 068959-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 126450728-126487696 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126484411 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1190 (T1190A)
Ref Sequence ENSEMBL: ENSMUSP00000045344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048391]
AlphaFold Q80YR7
Predicted Effect possibly damaging
Transcript: ENSMUST00000048391
AA Change: T1190A

PolyPhen 2 Score 0.597 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: T1190A

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
coiled coil region 159 187 N/A INTRINSIC
low complexity region 214 230 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 477 490 N/A INTRINSIC
coiled coil region 599 626 N/A INTRINSIC
low complexity region 632 658 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 732 753 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 968 975 N/A INTRINSIC
coiled coil region 1001 1036 N/A INTRINSIC
low complexity region 1045 1064 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik C A 9: 101,820,193 (GRCm39) D204E possibly damaging Het
Aldh3a2 A G 11: 61,156,037 (GRCm39) S80P probably benign Het
Bcl6b A T 11: 70,117,400 (GRCm39) Y407* probably null Het
Ccn2 T C 10: 24,471,856 (GRCm39) V49A probably benign Het
Cel TTA TTATA 2: 28,449,441 (GRCm39) probably null Het
Cerkl A T 2: 79,171,674 (GRCm39) C395S probably damaging Het
Chst5 C A 8: 112,617,492 (GRCm39) V43L probably benign Het
Clip1 A T 5: 123,784,337 (GRCm39) F271I probably damaging Het
Col20a1 A T 2: 180,648,528 (GRCm39) E938D probably damaging Het
Dmrta2 G A 4: 109,839,779 (GRCm39) V509M probably damaging Het
Dnah7b T A 1: 46,361,420 (GRCm39) M3440K probably benign Het
Erlin1 A G 19: 44,029,184 (GRCm39) probably null Het
Fam24b A G 7: 130,927,869 (GRCm39) S107P probably benign Het
Fancm T A 12: 65,149,358 (GRCm39) I708N probably benign Het
Fbxo11 A T 17: 88,323,124 (GRCm39) D12E Het
Fbxw13 T C 9: 109,024,116 (GRCm39) D39G probably damaging Het
Gabrb3 T G 7: 57,466,152 (GRCm39) L322R probably damaging Het
Gm5239 A T 18: 35,669,672 (GRCm39) I13F possibly damaging Het
Heatr1 A G 13: 12,419,802 (GRCm39) Y375C probably benign Het
Helq A T 5: 100,946,303 (GRCm39) S13T possibly damaging Het
Helz A G 11: 107,509,918 (GRCm39) T514A probably benign Het
Hook3 A G 8: 26,522,552 (GRCm39) V32A Het
Htra4 A G 8: 25,527,048 (GRCm39) I249T possibly damaging Het
Htt G T 5: 35,062,692 (GRCm39) V2809L probably benign Het
Ifi203 T A 1: 173,765,437 (GRCm39) I46F probably benign Het
Kcna2 A T 3: 107,012,306 (GRCm39) I296F possibly damaging Het
Kndc1 A G 7: 139,501,357 (GRCm39) E882G possibly damaging Het
Krtap16-1 A T 11: 99,876,071 (GRCm39) D444E probably benign Het
Lrrtm3 ATTTT ATTTTT 10: 63,925,035 (GRCm39) probably null Het
Mdga2 C T 12: 66,615,634 (GRCm39) D658N possibly damaging Het
Mkrn1 T C 6: 39,378,183 (GRCm39) K316R possibly damaging Het
Mmd2 C T 5: 142,553,666 (GRCm39) C165Y probably damaging Het
Mpdz A G 4: 81,202,867 (GRCm39) F1843L probably damaging Het
Mrc2 G A 11: 105,220,093 (GRCm39) R338Q probably damaging Het
Naip5 C T 13: 100,364,184 (GRCm39) R372H probably benign Het
Nav2 C A 7: 49,202,599 (GRCm39) S1461Y probably damaging Het
Nol8 T A 13: 49,814,738 (GRCm39) V282D possibly damaging Het
Nup98 C A 7: 101,834,167 (GRCm39) G265V possibly damaging Het
Or1ak2 T C 2: 36,827,911 (GRCm39) F260S probably damaging Het
Or2d3b A G 7: 106,513,980 (GRCm39) T192A possibly damaging Het
Or2h15 C T 17: 38,442,012 (GRCm39) E24K possibly damaging Het
Or4f58 T A 2: 111,851,517 (GRCm39) K227N possibly damaging Het
Or4f62 T A 2: 111,986,473 (GRCm39) M59K possibly damaging Het
Or8k18 G T 2: 86,085,544 (GRCm39) F164L possibly damaging Het
Otogl T A 10: 107,690,205 (GRCm39) E888D probably damaging Het
Pcdhgc4 A G 18: 37,948,685 (GRCm39) I34V possibly damaging Het
Ppp1r12b T C 1: 134,807,376 (GRCm39) R417G probably benign Het
Rtn4 A G 11: 29,656,778 (GRCm39) S311G probably benign Het
Serinc3 A G 2: 163,478,812 (GRCm39) V105A probably benign Het
Serpina3f A G 12: 104,183,444 (GRCm39) D102G possibly damaging Het
Sik3 A G 9: 46,066,772 (GRCm39) I184V probably damaging Het
Spopfm2 A C 3: 94,082,950 (GRCm39) L287R probably damaging Het
Tex35 A T 1: 156,935,436 (GRCm39) C21S probably benign Het
Tfap2b T C 1: 19,282,649 (GRCm39) probably null Het
Thbs4 C T 13: 92,897,998 (GRCm39) C607Y probably damaging Het
Tmem144 A T 3: 79,734,964 (GRCm39) N151K probably benign Het
Tomm70a T A 16: 56,963,166 (GRCm39) M395K probably benign Het
Trim43b A C 9: 88,967,663 (GRCm39) H324Q probably benign Het
Vmn2r116 A T 17: 23,620,141 (GRCm39) Y625F probably damaging Het
Yipf3 A T 17: 46,559,798 (GRCm39) N38I probably damaging Het
Zfp804b T A 5: 6,821,496 (GRCm39) E522D probably benign Het
Other mutations in Clspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Clspn APN 4 126,466,971 (GRCm39) missense probably damaging 1.00
IGL02160:Clspn APN 4 126,475,303 (GRCm39) missense probably benign 0.21
IGL02231:Clspn APN 4 126,453,021 (GRCm39) missense probably damaging 0.98
IGL02281:Clspn APN 4 126,459,563 (GRCm39) missense possibly damaging 0.90
IGL02368:Clspn APN 4 126,459,900 (GRCm39) missense probably benign
IGL03149:Clspn APN 4 126,470,295 (GRCm39) splice site probably benign
Durch UTSW 4 126,474,755 (GRCm39) missense probably damaging 0.99
R0012:Clspn UTSW 4 126,458,722 (GRCm39) unclassified probably benign
R0035:Clspn UTSW 4 126,458,796 (GRCm39) splice site probably null
R0035:Clspn UTSW 4 126,458,796 (GRCm39) splice site probably null
R0207:Clspn UTSW 4 126,484,391 (GRCm39) missense possibly damaging 0.82
R0270:Clspn UTSW 4 126,467,029 (GRCm39) missense probably damaging 1.00
R0825:Clspn UTSW 4 126,466,923 (GRCm39) splice site probably benign
R1082:Clspn UTSW 4 126,471,572 (GRCm39) missense possibly damaging 0.95
R1349:Clspn UTSW 4 126,457,770 (GRCm39) missense probably benign
R1568:Clspn UTSW 4 126,475,310 (GRCm39) missense probably benign 0.01
R1649:Clspn UTSW 4 126,460,228 (GRCm39) unclassified probably benign
R1663:Clspn UTSW 4 126,459,768 (GRCm39) missense probably benign 0.00
R2497:Clspn UTSW 4 126,466,140 (GRCm39) missense possibly damaging 0.79
R3107:Clspn UTSW 4 126,485,452 (GRCm39) missense probably benign 0.06
R3951:Clspn UTSW 4 126,470,172 (GRCm39) missense probably damaging 1.00
R3953:Clspn UTSW 4 126,460,230 (GRCm39) frame shift probably null
R3954:Clspn UTSW 4 126,460,230 (GRCm39) frame shift probably null
R3956:Clspn UTSW 4 126,460,230 (GRCm39) frame shift probably null
R4599:Clspn UTSW 4 126,475,253 (GRCm39) missense probably benign 0.14
R4717:Clspn UTSW 4 126,453,849 (GRCm39) missense probably damaging 1.00
R4853:Clspn UTSW 4 126,460,348 (GRCm39) missense probably damaging 0.99
R4854:Clspn UTSW 4 126,469,743 (GRCm39) missense probably benign
R4979:Clspn UTSW 4 126,472,179 (GRCm39) missense probably damaging 1.00
R5363:Clspn UTSW 4 126,455,579 (GRCm39) missense possibly damaging 0.58
R5531:Clspn UTSW 4 126,471,566 (GRCm39) missense probably benign
R5614:Clspn UTSW 4 126,474,755 (GRCm39) missense probably damaging 0.99
R5706:Clspn UTSW 4 126,472,211 (GRCm39) missense probably damaging 1.00
R5806:Clspn UTSW 4 126,479,899 (GRCm39) missense probably damaging 1.00
R6106:Clspn UTSW 4 126,484,434 (GRCm39) missense probably benign 0.00
R6178:Clspn UTSW 4 126,471,529 (GRCm39) splice site probably null
R6223:Clspn UTSW 4 126,479,961 (GRCm39) missense probably damaging 0.99
R6326:Clspn UTSW 4 126,459,532 (GRCm39) missense probably damaging 1.00
R6398:Clspn UTSW 4 126,457,740 (GRCm39) missense probably damaging 1.00
R6714:Clspn UTSW 4 126,459,561 (GRCm39) missense probably damaging 1.00
R7003:Clspn UTSW 4 126,486,513 (GRCm39) missense possibly damaging 0.63
R7034:Clspn UTSW 4 126,474,775 (GRCm39) missense possibly damaging 0.87
R7358:Clspn UTSW 4 126,459,993 (GRCm39) missense probably benign 0.02
R7376:Clspn UTSW 4 126,484,430 (GRCm39) missense possibly damaging 0.65
R7675:Clspn UTSW 4 126,460,113 (GRCm39) missense probably benign 0.00
R8320:Clspn UTSW 4 126,457,743 (GRCm39) missense possibly damaging 0.73
R8517:Clspn UTSW 4 126,460,012 (GRCm39) missense probably benign 0.00
R8547:Clspn UTSW 4 126,455,609 (GRCm39) missense probably damaging 1.00
R9106:Clspn UTSW 4 126,471,243 (GRCm39) intron probably benign
R9361:Clspn UTSW 4 126,479,654 (GRCm39) missense probably damaging 0.99
R9527:Clspn UTSW 4 126,453,792 (GRCm39) nonsense probably null
R9717:Clspn UTSW 4 126,458,756 (GRCm39) missense possibly damaging 0.90
T0975:Clspn UTSW 4 126,460,230 (GRCm39) unclassified probably benign
X0014:Clspn UTSW 4 126,469,736 (GRCm39) missense probably damaging 1.00
Z1177:Clspn UTSW 4 126,459,970 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGAAGGTAATGTAATGTTGCATG -3'
(R):5'- TAAGAGACAACGTCTGCCTCTCC -3'

Sequencing Primer
(F):5'- CAGAGGCTGGTCTCTCATTATG -3'
(R):5'- CTCACCTCAATGGCTCCTTTAAGAC -3'
Posted On 2022-02-07