Mutagenetix > Incidental Mutation

Incidental Mutation 'R9223:Mdga2'

699616

Institutional Source

Beutler Lab

Gene Symbol

Mdga2

Ensembl Gene

ENSMUSG00000034912

Gene Name

MAM domain containing glycosylphosphatidylinositol anchor 2

Synonyms

Adp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2

MMRRC Submission

068959-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

66466060-67222549 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 66568860 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 658 (D658N)

Ref Sequence

ENSEMBL: ENSMUSP00000046761 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]

AlphaFold

P60755

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037181
AA Change: D658N

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: D658N

Domain	Start	End	E-Value	Type
IGc2	122	186	1.38e-15	SMART
IG	213	307	1.79e0	SMART
IGc2	324	386	1.56e-14	SMART
IGc2	419	493	4.43e-5	SMART
low complexity region	495	507	N/A	INTRINSIC
IGc2	525	591	1.97e-11	SMART
IG_like	621	687	2.5e0	SMART
Blast:FN3	707	795	4e-40	BLAST
MAM	812	990	3.4e-49	SMART
transmembrane domain	999	1021	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000101379

SMART Domains

Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
SCOP:d1cs6a1	40	72	2e-5	SMART
Blast:IG	47	72	9e-11	BLAST

Predicted Effect

SMART Domains

Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: D648N

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
IGc2	53	117	1.38e-15	SMART
IG	144	238	1.79e0	SMART
IGc2	255	317	1.56e-14	SMART
IGc2	350	424	4.43e-5	SMART
low complexity region	426	438	N/A	INTRINSIC
IGc2	456	522	1.97e-11	SMART
IG_like	552	618	2.5e0	SMART
Blast:FN3	638	726	3e-40	BLAST
MAM	736	914	1.38e-49	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000222167
AA Change: D589N

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223141
AA Change: D589N

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9630041A04Rik	C	A	9: 101,942,994	D204E	possibly damaging	Het
Aldh3a2	A	G	11: 61,265,211	S80P	probably benign	Het
Bcl6b	A	T	11: 70,226,574	Y407*	probably null	Het
Cel	TTA	TTATA	2: 28,559,429		probably null	Het
Cerkl	A	T	2: 79,341,330	C395S	probably damaging	Het
Chst5	C	A	8: 111,890,860	V43L	probably benign	Het
Clip1	A	T	5: 123,646,274	F271I	probably damaging	Het
Clspn	A	G	4: 126,590,618	T1190A	possibly damaging	Het
Col20a1	A	T	2: 181,006,735	E938D	probably damaging	Het
Ctgf	T	C	10: 24,595,958	V49A	probably benign	Het
Dmrta2	G	A	4: 109,982,582	V509M	probably damaging	Het
Dnah7b	T	A	1: 46,322,260	M3440K	probably benign	Het
Erlin1	A	G	19: 44,040,745		probably null	Het
Fam24b	A	G	7: 131,326,140	S107P	probably benign	Het
Fancm	T	A	12: 65,102,584	I708N	probably benign	Het
Fbxo11	A	T	17: 88,015,696	D12E		Het
Fbxw13	T	C	9: 109,195,048	D39G	probably damaging	Het
Gabrb3	T	G	7: 57,816,404	L322R	probably damaging	Het
Gm10696	A	C	3: 94,175,643	L287R	probably damaging	Het
Gm5239	A	T	18: 35,536,619	I13F	possibly damaging	Het
Heatr1	A	G	13: 12,404,921	Y375C	probably benign	Het
Helq	A	T	5: 100,798,437	S13T	possibly damaging	Het
Helz	A	G	11: 107,619,092	T514A	probably benign	Het
Hook3	A	G	8: 26,032,524	V32A		Het
Htra4	A	G	8: 25,037,032	I249T	possibly damaging	Het
Htt	G	T	5: 34,905,348	V2809L	probably benign	Het
Ifi203	T	A	1: 173,937,871	I46F	probably benign	Het
Kcna2	A	T	3: 107,104,990	I296F	possibly damaging	Het
Kndc1	A	G	7: 139,921,441	E882G	possibly damaging	Het
Krtap16-1	A	T	11: 99,985,245	D444E	probably benign	Het
Lrrtm3	ATTTT	ATTTTT	10: 64,089,256		probably null	Het
Mkrn1	T	C	6: 39,401,249	K316R	possibly damaging	Het
Mmd2	C	T	5: 142,567,911	C165Y	probably damaging	Het
Mpdz	A	G	4: 81,284,630	F1843L	probably damaging	Het
Mrc2	G	A	11: 105,329,267	R338Q	probably damaging	Het
Naip5	C	T	13: 100,227,676	R372H	probably benign	Het
Nav2	C	A	7: 49,552,851	S1461Y	probably damaging	Het
Nol8	T	A	13: 49,661,262	V282D	possibly damaging	Het
Nup98	C	A	7: 102,184,960	G265V	possibly damaging	Het
Olfr1049	G	T	2: 86,255,200	F164L	possibly damaging	Het
Olfr1311	T	A	2: 112,021,172	K227N	possibly damaging	Het
Olfr1318	T	A	2: 112,156,128	M59K	possibly damaging	Het
Olfr132	C	T	17: 38,131,121	E24K	possibly damaging	Het
Olfr1532-ps1	A	G	7: 106,914,773	T192A	possibly damaging	Het
Olfr356	T	C	2: 36,937,899	F260S	probably damaging	Het
Otogl	T	A	10: 107,854,344	E888D	probably damaging	Het
Pcdhgc4	A	G	18: 37,815,632	I34V	possibly damaging	Het
Ppp1r12b	T	C	1: 134,879,638	R417G	probably benign	Het
Rtn4	A	G	11: 29,706,778	S311G	probably benign	Het
Serinc3	A	G	2: 163,636,892	V105A	probably benign	Het
Serpina3f	A	G	12: 104,217,185	D102G	possibly damaging	Het
Sik3	A	G	9: 46,155,474	I184V	probably damaging	Het
Tex35	A	T	1: 157,107,866	C21S	probably benign	Het
Tfap2b	T	C	1: 19,212,425		probably null	Het
Thbs4	C	T	13: 92,761,490	C607Y	probably damaging	Het
Tmem144	A	T	3: 79,827,657	N151K	probably benign	Het
Tomm70a	T	A	16: 57,142,803	M395K	probably benign	Het
Trim43b	A	C	9: 89,085,610	H324Q	probably benign	Het
Vmn2r116	A	T	17: 23,401,167	Y625F	probably damaging	Het
Yipf3	A	T	17: 46,248,872	N38I	probably damaging	Het
Zfp804b	T	A	5: 6,771,496	E522D	probably benign	Het

Other mutations in Mdga2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Mdga2	APN	12	66723109	missense	probably damaging	0.97
IGL01632:Mdga2	APN	12	66629898	splice site	probably benign
IGL01843:Mdga2	APN	12	66723131	critical splice acceptor site	probably null
IGL02230:Mdga2	APN	12	66655423	nonsense	probably null
IGL02348:Mdga2	APN	12	66550575	missense	probably damaging	1.00
IGL02473:Mdga2	APN	12	66550611	missense	possibly damaging	0.73
IGL02795:Mdga2	APN	12	66689432	missense	probably benign	0.00
IGL02901:Mdga2	APN	12	66797809	splice site	probably benign
IGL03373:Mdga2	APN	12	66716722	missense	probably damaging	0.99
PIT4362001:Mdga2	UTSW	12	66797768	missense	possibly damaging	0.83
PIT4377001:Mdga2	UTSW	12	66716695	missense	probably damaging	0.99
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0106:Mdga2	UTSW	12	66716706	missense	probably damaging	1.00
R0110:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0218:Mdga2	UTSW	12	66655120	missense	probably damaging	1.00
R0450:Mdga2	UTSW	12	66470926	missense	possibly damaging	0.66
R0801:Mdga2	UTSW	12	66486733	missense	probably damaging	1.00
R0847:Mdga2	UTSW	12	66723080	missense	probably damaging	1.00
R1056:Mdga2	UTSW	12	66723120	missense	probably damaging	0.97
R1086:Mdga2	UTSW	12	66506102	splice site	probably benign
R1335:Mdga2	UTSW	12	66716742	splice site	probably null
R1382:Mdga2	UTSW	12	66470916	missense	possibly damaging	0.68
R1490:Mdga2	UTSW	12	66797756	missense	probably benign	0.01
R1521:Mdga2	UTSW	12	66568926	missense	probably benign	0.00
R1556:Mdga2	UTSW	12	66550593	missense	possibly damaging	0.92
R1676:Mdga2	UTSW	12	66568772	missense	probably damaging	1.00
R1676:Mdga2	UTSW	12	66568773	nonsense	probably null
R1698:Mdga2	UTSW	12	66689335	missense	probably damaging	0.97
R1954:Mdga2	UTSW	12	66486708	splice site	probably benign
R2069:Mdga2	UTSW	12	66568917	nonsense	probably null
R2077:Mdga2	UTSW	12	66655362	missense	probably damaging	1.00
R2118:Mdga2	UTSW	12	66868752	missense	probably damaging	1.00
R2146:Mdga2	UTSW	12	66868741	missense	probably damaging	1.00
R2158:Mdga2	UTSW	12	66689381	missense	possibly damaging	0.64
R2189:Mdga2	UTSW	12	66473196	splice site	probably null
R2293:Mdga2	UTSW	12	66568985	nonsense	probably null
R2886:Mdga2	UTSW	12	66506270	splice site	probably benign
R2960:Mdga2	UTSW	12	66629978	nonsense	probably null
R3937:Mdga2	UTSW	12	67221206	unclassified	probably benign
R4437:Mdga2	UTSW	12	66473198	splice site	probably null
R4514:Mdga2	UTSW	12	66716722	missense	probably damaging	0.99
R4693:Mdga2	UTSW	12	66797633	missense	possibly damaging	0.81
R4719:Mdga2	UTSW	12	66471001	unclassified	probably benign
R4744:Mdga2	UTSW	12	66797727	missense	probably benign	0.01
R4756:Mdga2	UTSW	12	66797653	missense	probably damaging	1.00
R4781:Mdga2	UTSW	12	66797622	splice site	probably null
R5022:Mdga2	UTSW	12	66470760	missense	possibly damaging	0.83
R5108:Mdga2	UTSW	12	66486741	missense	probably benign	0.43
R5479:Mdga2	UTSW	12	66655176	missense	probably damaging	1.00
R5710:Mdga2	UTSW	12	66506782	missense	probably damaging	1.00
R5816:Mdga2	UTSW	12	66655182	missense	probably damaging	1.00
R5822:Mdga2	UTSW	12	66655335	missense	probably damaging	1.00
R5996:Mdga2	UTSW	12	66797763	missense	probably benign	0.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6038:Mdga2	UTSW	12	66630053	missense	probably damaging	1.00
R6297:Mdga2	UTSW	12	66506253	missense	probably damaging	1.00
R6484:Mdga2	UTSW	12	66630069	missense	possibly damaging	0.90
R6830:Mdga2	UTSW	12	66723001	missense	probably damaging	1.00
R6912:Mdga2	UTSW	12	66506115	missense	probably benign	0.01
R6971:Mdga2	UTSW	12	66550561	missense	probably damaging	1.00
R7053:Mdga2	UTSW	12	66689384	missense	probably benign	0.41
R7069:Mdga2	UTSW	12	66486752	missense	probably benign	0.31
R7381:Mdga2	UTSW	12	66568896	missense	probably benign	0.44
R7474:Mdga2	UTSW	12	66486761	nonsense	probably null
R7559:Mdga2	UTSW	12	66473229	missense	probably damaging	1.00
R7581:Mdga2	UTSW	12	66506255	missense	probably damaging	0.99
R7596:Mdga2	UTSW	12	66506123	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689350	missense	probably damaging	0.99
R7745:Mdga2	UTSW	12	66689351	missense	possibly damaging	0.63
R7852:Mdga2	UTSW	12	66470950	missense	possibly damaging	0.66
R8144:Mdga2	UTSW	12	66655263	missense	probably damaging	1.00
R8319:Mdga2	UTSW	12	67221029	missense	unknown
R8715:Mdga2	UTSW	12	66868752	missense	probably damaging	1.00
R8977:Mdga2	UTSW	12	66797635	missense	possibly damaging	0.88
R9138:Mdga2	UTSW	12	66568889	missense	possibly damaging	0.89
R9177:Mdga2	UTSW	12	66470707	missense	possibly damaging	0.66
R9248:Mdga2	UTSW	12	66689452	missense	possibly damaging	0.87
R9264:Mdga2	UTSW	12	66513283	missense	probably damaging	1.00
R9381:Mdga2	UTSW	12	66550530	missense	possibly damaging	0.64
R9456:Mdga2	UTSW	12	66568758	missense	probably benign	0.44
R9633:Mdga2	UTSW	12	66689432	missense	probably benign	0.00
Z1176:Mdga2	UTSW	12	66689443	missense	probably damaging	1.00
Z1186:Mdga2	UTSW	12	66568953	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AAGATCCGTTGCTTTGATGGC -3'
(R):5'- TCCTCATAATTGAAAAGCCAAGGAG -3'

Sequencing Primer
(F):5'- AAAGCTGCATCTCCCTG -3'
(R):5'- CCAAGGAGATTGCTGTTTTGAAATCC -3'

Posted On

2022-02-07