Incidental Mutation 'R9223:Mdga2'
ID 699616
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene Name MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms Adp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9223 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 66466060-67222549 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 66568860 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 658 (D658N)
Ref Sequence ENSEMBL: ENSMUSP00000046761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
AlphaFold P60755
Predicted Effect possibly damaging
Transcript: ENSMUST00000037181
AA Change: D658N

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: D658N

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: D648N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000222167
AA Change: D589N

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223141
AA Change: D589N

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9630041A04Rik C A 9: 101,942,994 D204E possibly damaging Het
Aldh3a2 A G 11: 61,265,211 S80P probably benign Het
Bcl6b A T 11: 70,226,574 Y407* probably null Het
Cel TTA TTATA 2: 28,559,429 probably null Het
Cerkl A T 2: 79,341,330 C395S probably damaging Het
Chst5 C A 8: 111,890,860 V43L probably benign Het
Clip1 A T 5: 123,646,274 F271I probably damaging Het
Clspn A G 4: 126,590,618 T1190A possibly damaging Het
Col20a1 A T 2: 181,006,735 E938D probably damaging Het
Ctgf T C 10: 24,595,958 V49A probably benign Het
Dmrta2 G A 4: 109,982,582 V509M probably damaging Het
Dnah7b T A 1: 46,322,260 M3440K probably benign Het
Erlin1 A G 19: 44,040,745 probably null Het
Fam24b A G 7: 131,326,140 S107P probably benign Het
Fancm T A 12: 65,102,584 I708N probably benign Het
Fbxo11 A T 17: 88,015,696 D12E Het
Fbxw13 T C 9: 109,195,048 D39G probably damaging Het
Gabrb3 T G 7: 57,816,404 L322R probably damaging Het
Gm10696 A C 3: 94,175,643 L287R probably damaging Het
Gm5239 A T 18: 35,536,619 I13F possibly damaging Het
Heatr1 A G 13: 12,404,921 Y375C probably benign Het
Helq A T 5: 100,798,437 S13T possibly damaging Het
Helz A G 11: 107,619,092 T514A probably benign Het
Hook3 A G 8: 26,032,524 V32A Het
Htra4 A G 8: 25,037,032 I249T possibly damaging Het
Htt G T 5: 34,905,348 V2809L probably benign Het
Ifi203 T A 1: 173,937,871 I46F probably benign Het
Kcna2 A T 3: 107,104,990 I296F possibly damaging Het
Kndc1 A G 7: 139,921,441 E882G possibly damaging Het
Krtap16-1 A T 11: 99,985,245 D444E probably benign Het
Lrrtm3 ATTTT ATTTTT 10: 64,089,256 probably null Het
Mkrn1 T C 6: 39,401,249 K316R possibly damaging Het
Mmd2 C T 5: 142,567,911 C165Y probably damaging Het
Mpdz A G 4: 81,284,630 F1843L probably damaging Het
Mrc2 G A 11: 105,329,267 R338Q probably damaging Het
Naip5 C T 13: 100,227,676 R372H probably benign Het
Nav2 C A 7: 49,552,851 S1461Y probably damaging Het
Nol8 T A 13: 49,661,262 V282D possibly damaging Het
Nup98 C A 7: 102,184,960 G265V possibly damaging Het
Olfr1049 G T 2: 86,255,200 F164L possibly damaging Het
Olfr1311 T A 2: 112,021,172 K227N possibly damaging Het
Olfr1318 T A 2: 112,156,128 M59K possibly damaging Het
Olfr132 C T 17: 38,131,121 E24K possibly damaging Het
Olfr1532-ps1 A G 7: 106,914,773 T192A possibly damaging Het
Olfr356 T C 2: 36,937,899 F260S probably damaging Het
Otogl T A 10: 107,854,344 E888D probably damaging Het
Pcdhgc4 A G 18: 37,815,632 I34V possibly damaging Het
Ppp1r12b T C 1: 134,879,638 R417G probably benign Het
Rtn4 A G 11: 29,706,778 S311G probably benign Het
Serinc3 A G 2: 163,636,892 V105A probably benign Het
Serpina3f A G 12: 104,217,185 D102G possibly damaging Het
Sik3 A G 9: 46,155,474 I184V probably damaging Het
Tex35 A T 1: 157,107,866 C21S probably benign Het
Tfap2b T C 1: 19,212,425 probably null Het
Thbs4 C T 13: 92,761,490 C607Y probably damaging Het
Tmem144 A T 3: 79,827,657 N151K probably benign Het
Tomm70a T A 16: 57,142,803 M395K probably benign Het
Trim43b A C 9: 89,085,610 H324Q probably benign Het
Vmn2r116 A T 17: 23,401,167 Y625F probably damaging Het
Yipf3 A T 17: 46,248,872 N38I probably damaging Het
Zfp804b T A 5: 6,771,496 E522D probably benign Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2069:Mdga2 UTSW 12 66568917 nonsense probably null
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66506255 missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66506123 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689350 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689351 missense possibly damaging 0.63
R7852:Mdga2 UTSW 12 66470950 missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66655263 missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67221029 missense unknown
R8715:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R8977:Mdga2 UTSW 12 66797635 missense possibly damaging 0.88
R9138:Mdga2 UTSW 12 66568889 missense possibly damaging 0.89
R9177:Mdga2 UTSW 12 66470707 missense possibly damaging 0.66
R9248:Mdga2 UTSW 12 66689452 missense possibly damaging 0.87
R9264:Mdga2 UTSW 12 66513283 missense probably damaging 1.00
R9381:Mdga2 UTSW 12 66550530 missense possibly damaging 0.64
R9456:Mdga2 UTSW 12 66568758 missense probably benign 0.44
R9633:Mdga2 UTSW 12 66689432 missense probably benign 0.00
Z1176:Mdga2 UTSW 12 66689443 missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66568953 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AAGATCCGTTGCTTTGATGGC -3'
(R):5'- TCCTCATAATTGAAAAGCCAAGGAG -3'

Sequencing Primer
(F):5'- AAAGCTGCATCTCCCTG -3'
(R):5'- CCAAGGAGATTGCTGTTTTGAAATCC -3'
Posted On 2022-02-07