Incidental Mutation 'R9224:Fcnb'
ID 699634
Institutional Source Beutler Lab
Gene Symbol Fcnb
Ensembl Gene ENSMUSG00000026835
Gene Name ficolin B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9224 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 28076378-28084885 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 28079148 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 179 (D179V)
Ref Sequence ENSEMBL: ENSMUSP00000028179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028179] [ENSMUST00000117486] [ENSMUST00000135472]
AlphaFold O70497
Predicted Effect probably damaging
Transcript: ENSMUST00000028179
AA Change: D179V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028179
Gene: ENSMUSG00000026835
AA Change: D179V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 1.1e-11 PFAM
FBG 101 314 1.78e-115 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117486
AA Change: D179V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112625
Gene: ENSMUSG00000026835
AA Change: D179V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 39 99 6.7e-12 PFAM
FBG 101 250 1.33e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135472
SMART Domains Protein: ENSMUSP00000119098
Gene: ENSMUSG00000026835

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Collagen 38 81 5.3e-10 PFAM
internal_repeat_1 86 107 1.19e-5 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. The collagen-like and the fibrinogen-like domains are also found separately in other proteins such as complement protein C1q, C-type lectins known as collectins, and tenascins. However, all these proteins recognize different targets, and are functionally distinct. Ficolin 1 encoded by FCN1 is predominantly expressed in the peripheral blood leukocytes, and has been postulated to function as a plasma protein with elastin-binding activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to Streptococcus pneumoniae infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,100 S229L possibly damaging Het
Actc1 TGA T 2: 114,049,229 probably null Het
Actl9 G A 17: 33,434,030 A355T probably benign Het
Adamts8 A G 9: 30,942,892 Q19R probably benign Het
Akr1c14 A T 13: 4,080,695 Y216F possibly damaging Het
Alms1 T C 6: 85,621,788 C1199R possibly damaging Het
Apc2 T C 10: 80,314,277 S1722P probably damaging Het
Arid1a T C 4: 133,681,856 E1395G unknown Het
Atp6v0e2 T C 6: 48,539,256 V46A possibly damaging Het
Bcar3 A G 3: 122,525,442 R743G probably damaging Het
Bhmt2 A G 13: 93,669,346 V56A probably damaging Het
Bsn C A 9: 108,105,487 R917L Het
Cabyr T G 18: 12,754,221 V303G possibly damaging Het
Carmil1 A T 13: 24,108,529 I429N probably damaging Het
Ccdc27 T C 4: 154,037,717 N235D unknown Het
Ccdc61 T C 7: 18,903,821 M37V probably benign Het
Cd40 A T 2: 165,056,796 I48F unknown Het
Cdk13 A T 13: 17,766,486 S664R probably damaging Het
Cel TTA TTATA 2: 28,559,429 probably null Het
Cfap46 T A 7: 139,678,500 R286* probably null Het
Ckap2 A C 8: 22,169,938 I509S possibly damaging Het
Clptm1l A T 13: 73,604,225 probably benign Het
Col11a1 T G 3: 114,208,280 M1591R unknown Het
Col6a5 C A 9: 105,937,395 A473S unknown Het
Cxcr2 T A 1: 74,158,597 D83E probably damaging Het
Cyp2c39 G A 19: 39,538,888 C226Y probably benign Het
Ddr1 A C 17: 35,689,717 F352C probably damaging Het
Defb22 T A 2: 152,485,801 T155S unknown Het
Dennd4c G T 4: 86,819,933 E935* probably null Het
Dst A C 1: 34,291,798 E4889D probably damaging Het
Emilin1 T A 5: 30,917,479 C355S probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Ficd T A 5: 113,737,135 D88E probably benign Het
Fndc3b T C 3: 27,470,301 K437E possibly damaging Het
Fyb2 T A 4: 104,995,908 W566R probably benign Het
Gm11639 A G 11: 104,770,975 Q1314R probably benign Het
Gm14403 A G 2: 177,508,543 Q94R probably benign Het
Gm14548 T C 7: 3,897,235 T123A probably benign Het
Gm32687 T A 10: 81,879,032 I86N probably benign Het
Gpam T G 19: 55,087,475 D235A probably damaging Het
Gstt4 T C 10: 75,815,212 E192G probably damaging Het
H2-Q6 T G 17: 35,425,333 V97G probably benign Het
Hcn1 G A 13: 117,925,718 G507S unknown Het
Hydin T C 8: 110,532,884 I2496T probably benign Het
Jund A G 8: 70,699,215 D53G probably damaging Het
Kat6b T A 14: 21,669,963 M1461K probably benign Het
Lnx1 T G 5: 74,606,149 K435Q probably benign Het
Lpcat1 C A 13: 73,510,042 L316M probably damaging Het
Lrrtm3 ATTTT ATTTTT 10: 64,089,256 probably null Het
Ly6c1 T A 15: 75,044,616 T126S probably benign Het
Macf1 A G 4: 123,432,897 S4938P probably damaging Het
Map2k2 T C 10: 81,118,174 V158A possibly damaging Het
Map3k4 A G 17: 12,238,086 V1323A probably damaging Het
Map4k5 A T 12: 69,892,693 V23E possibly damaging Het
Med30 T G 15: 52,719,443 L92R probably damaging Het
Mroh8 C T 2: 157,221,149 G851S possibly damaging Het
Msmb T A 14: 32,158,103 C83* probably null Het
Mtif2 A T 11: 29,544,364 R655S probably benign Het
Myo10 C T 15: 25,807,995 S1901L probably benign Het
Myom2 A T 8: 15,128,804 I1279F possibly damaging Het
Nat9 T C 11: 115,184,615 I67V probably damaging Het
Ncam1 A G 9: 49,508,695 S774P probably damaging Het
Ndufaf6 T C 4: 11,062,089 T181A probably damaging Het
Nlrp4f T A 13: 65,185,015 K110* probably null Het
Nlrp9b T C 7: 20,019,292 S41P probably benign Het
Nlrp9b A G 7: 20,023,551 T238A probably benign Het
Noxo1 A T 17: 24,700,331 E342D probably benign Het
Nt5dc2 T C 14: 31,135,708 M55T probably benign Het
Olfr1040 T A 2: 86,145,876 N286I probably damaging Het
Olfr342 A T 2: 36,527,826 Q138L probably benign Het
Olfr453 T C 6: 42,744,970 F311S probably benign Het
Olfr466 C T 13: 65,152,389 T55I probably damaging Het
Olfr700 T C 7: 106,806,282 Y60C probably damaging Het
Olfr782 T A 10: 129,350,581 M6K probably benign Het
Olfr800 C A 10: 129,660,138 L111M probably damaging Het
Olfr92 T C 17: 37,111,875 T36A possibly damaging Het
P4ha2 C T 11: 54,119,137 P240L possibly damaging Het
Pcdha11 T A 18: 37,006,020 L234Q probably damaging Het
Pgm3 C T 9: 86,556,362 A457T probably benign Het
Pkp4 T C 2: 59,314,394 V533A probably benign Het
Plac8l1 T C 18: 42,192,637 T68A possibly damaging Het
Pou2f3 A T 9: 43,139,399 I222N probably damaging Het
Ppp1r14d T C 2: 119,229,741 D20G probably benign Het
Ppp1r37 C A 7: 19,531,804 G679V probably damaging Het
Ppp6r2 T A 15: 89,262,396 I199N probably damaging Het
Prune2 A G 19: 17,120,029 T966A probably damaging Het
Ptdss2 T C 7: 141,154,885 V375A probably benign Het
Rara TGCCCCGC TGCCCCGCCCCGC 11: 98,966,410 probably null Het
Rin2 T A 2: 145,878,902 C718* probably null Het
Rptor C T 11: 119,894,287 T1170I probably benign Het
Samd5 T C 10: 9,674,515 Y150C probably damaging Het
Setd1b T C 5: 123,158,710 S1245P unknown Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc29a1 C A 17: 45,586,227 V378L probably damaging Het
Slc2a12 T G 10: 22,665,362 I372S possibly damaging Het
Slc7a10 T A 7: 35,195,214 Y99* probably null Het
Smco3 A G 6: 136,831,519 V119A probably damaging Het
Sptlc3 C T 2: 139,494,234 T10I probably benign Het
Sri T A 5: 8,063,323 W105R probably damaging Het
Stk35 T C 2: 129,810,571 Y331H probably damaging Het
Tipin T C 9: 64,288,148 I12T probably benign Het
Tlr5 A G 1: 182,975,128 T666A probably benign Het
Tmprss11g C A 5: 86,492,144 V222L probably benign Het
Tnfrsf11b T A 15: 54,252,160 Y347F possibly damaging Het
Traf6 A G 2: 101,697,167 T421A probably benign Het
Trrap T A 5: 144,771,239 D30E possibly damaging Het
Ube2k T A 5: 65,594,504 Y162N probably damaging Het
Uck2 A T 1: 167,237,602 V49E probably damaging Het
Vcam1 A T 3: 116,110,943 Y718* probably null Het
Zan T C 5: 137,474,007 N159S probably damaging Het
Zfp438 A G 18: 5,210,788 L750P probably damaging Het
Zfp54 A T 17: 21,433,775 Y177F probably benign Het
Other mutations in Fcnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Fcnb APN 2 28076801 missense probably benign 0.04
IGL02130:Fcnb APN 2 28084789 critical splice donor site probably null
IGL02348:Fcnb APN 2 28084830 missense possibly damaging 0.88
IGL02504:Fcnb APN 2 28076594 missense probably damaging 1.00
IGL03118:Fcnb APN 2 28076618 missense probably benign 0.06
IGL03179:Fcnb APN 2 28076634 missense possibly damaging 0.93
R0217:Fcnb UTSW 2 28079677 missense probably benign 0.02
R0899:Fcnb UTSW 2 28076779 missense probably damaging 1.00
R3901:Fcnb UTSW 2 28079196 missense probably damaging 1.00
R5845:Fcnb UTSW 2 28079621 critical splice donor site probably null
R5911:Fcnb UTSW 2 28076689 missense probably damaging 1.00
R6065:Fcnb UTSW 2 28079910 missense probably damaging 1.00
R6188:Fcnb UTSW 2 28079190 missense possibly damaging 0.94
R6488:Fcnb UTSW 2 28078289 missense probably damaging 1.00
R8058:Fcnb UTSW 2 28079695 missense probably damaging 1.00
R8194:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8195:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8196:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8198:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8199:Fcnb UTSW 2 28078318 missense possibly damaging 0.65
R8678:Fcnb UTSW 2 28078349 missense possibly damaging 0.61
R9261:Fcnb UTSW 2 28079624 missense probably damaging 0.99
X0024:Fcnb UTSW 2 28076691 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGGCTGGGTCCTGAGAAG -3'
(R):5'- GAATCTTGGATTCCTGCTCTGC -3'

Sequencing Primer
(F):5'- CACAGTTTAGAGGAGGCCCTTATC -3'
(R):5'- GATTCCTGCTCTGCTTTGAGGC -3'
Posted On 2022-02-07