Incidental Mutation 'R9224:Cfap46'
ID 699679
Institutional Source Beutler Lab
Gene Symbol Cfap46
Ensembl Gene ENSMUSG00000049571
Gene Name cilia and flagella associated protein 46
Synonyms 9330101J02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9224 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 139600951-139683817 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 139678500 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 286 (R286*)
Ref Sequence ENSEMBL: ENSMUSP00000120186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000130453] [ENSMUST00000140820]
AlphaFold E9Q2C0
Predicted Effect probably null
Transcript: ENSMUST00000129990
AA Change: R286*
SMART Domains Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: R286*

DomainStartEndE-ValueType
Blast:TPR 175 207 7e-11 BLAST
Blast:TPR 426 459 1e-11 BLAST
low complexity region 868 879 N/A INTRINSIC
Blast:TPR 936 969 2e-7 BLAST
Blast:TPR 1112 1145 1e-9 BLAST
coiled coil region 1347 1423 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130453
SMART Domains Protein: ENSMUSP00000115437
Gene: ENSMUSG00000049571

DomainStartEndE-ValueType
Blast:TPR 116 149 1e-11 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000140820
AA Change: R286*
SMART Domains Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571
AA Change: R286*

DomainStartEndE-ValueType
Blast:TPR 175 208 5e-11 BLAST
Blast:TPR 426 459 8e-12 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,100 S229L possibly damaging Het
Actc1 TGA T 2: 114,049,229 probably null Het
Actl9 G A 17: 33,434,030 A355T probably benign Het
Adamts8 A G 9: 30,942,892 Q19R probably benign Het
Akr1c14 A T 13: 4,080,695 Y216F possibly damaging Het
Alms1 T C 6: 85,621,788 C1199R possibly damaging Het
Apc2 T C 10: 80,314,277 S1722P probably damaging Het
Arid1a T C 4: 133,681,856 E1395G unknown Het
Atp6v0e2 T C 6: 48,539,256 V46A possibly damaging Het
Bcar3 A G 3: 122,525,442 R743G probably damaging Het
Bhmt2 A G 13: 93,669,346 V56A probably damaging Het
Bsn C A 9: 108,105,487 R917L Het
Cabyr T G 18: 12,754,221 V303G possibly damaging Het
Carmil1 A T 13: 24,108,529 I429N probably damaging Het
Ccdc27 T C 4: 154,037,717 N235D unknown Het
Ccdc61 T C 7: 18,903,821 M37V probably benign Het
Cd40 A T 2: 165,056,796 I48F unknown Het
Cdk13 A T 13: 17,766,486 S664R probably damaging Het
Cel TTA TTATA 2: 28,559,429 probably null Het
Ckap2 A C 8: 22,169,938 I509S possibly damaging Het
Clptm1l A T 13: 73,604,225 probably benign Het
Col11a1 T G 3: 114,208,280 M1591R unknown Het
Col6a5 C A 9: 105,937,395 A473S unknown Het
Cxcr2 T A 1: 74,158,597 D83E probably damaging Het
Cyp2c39 G A 19: 39,538,888 C226Y probably benign Het
Ddr1 A C 17: 35,689,717 F352C probably damaging Het
Defb22 T A 2: 152,485,801 T155S unknown Het
Dennd4c G T 4: 86,819,933 E935* probably null Het
Dst A C 1: 34,291,798 E4889D probably damaging Het
Emilin1 T A 5: 30,917,479 C355S probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Fcnb T A 2: 28,079,148 D179V probably damaging Het
Ficd T A 5: 113,737,135 D88E probably benign Het
Fndc3b T C 3: 27,470,301 K437E possibly damaging Het
Fyb2 T A 4: 104,995,908 W566R probably benign Het
Gm11639 A G 11: 104,770,975 Q1314R probably benign Het
Gm14403 A G 2: 177,508,543 Q94R probably benign Het
Gm14548 T C 7: 3,897,235 T123A probably benign Het
Gm32687 T A 10: 81,879,032 I86N probably benign Het
Gpam T G 19: 55,087,475 D235A probably damaging Het
Gstt4 T C 10: 75,815,212 E192G probably damaging Het
H2-Q6 T G 17: 35,425,333 V97G probably benign Het
Hcn1 G A 13: 117,925,718 G507S unknown Het
Hydin T C 8: 110,532,884 I2496T probably benign Het
Jund A G 8: 70,699,215 D53G probably damaging Het
Kat6b T A 14: 21,669,963 M1461K probably benign Het
Lnx1 T G 5: 74,606,149 K435Q probably benign Het
Lpcat1 C A 13: 73,510,042 L316M probably damaging Het
Lrrtm3 ATTTT ATTTTT 10: 64,089,256 probably null Het
Ly6c1 T A 15: 75,044,616 T126S probably benign Het
Macf1 A G 4: 123,432,897 S4938P probably damaging Het
Map2k2 T C 10: 81,118,174 V158A possibly damaging Het
Map3k4 A G 17: 12,238,086 V1323A probably damaging Het
Map4k5 A T 12: 69,892,693 V23E possibly damaging Het
Med30 T G 15: 52,719,443 L92R probably damaging Het
Mroh8 C T 2: 157,221,149 G851S possibly damaging Het
Msmb T A 14: 32,158,103 C83* probably null Het
Mtif2 A T 11: 29,544,364 R655S probably benign Het
Myo10 C T 15: 25,807,995 S1901L probably benign Het
Myom2 A T 8: 15,128,804 I1279F possibly damaging Het
Nat9 T C 11: 115,184,615 I67V probably damaging Het
Ncam1 A G 9: 49,508,695 S774P probably damaging Het
Ndufaf6 T C 4: 11,062,089 T181A probably damaging Het
Nlrp4f T A 13: 65,185,015 K110* probably null Het
Nlrp9b T C 7: 20,019,292 S41P probably benign Het
Nlrp9b A G 7: 20,023,551 T238A probably benign Het
Noxo1 A T 17: 24,700,331 E342D probably benign Het
Nt5dc2 T C 14: 31,135,708 M55T probably benign Het
Olfr1040 T A 2: 86,145,876 N286I probably damaging Het
Olfr342 A T 2: 36,527,826 Q138L probably benign Het
Olfr453 T C 6: 42,744,970 F311S probably benign Het
Olfr466 C T 13: 65,152,389 T55I probably damaging Het
Olfr700 T C 7: 106,806,282 Y60C probably damaging Het
Olfr782 T A 10: 129,350,581 M6K probably benign Het
Olfr800 C A 10: 129,660,138 L111M probably damaging Het
Olfr92 T C 17: 37,111,875 T36A possibly damaging Het
P4ha2 C T 11: 54,119,137 P240L possibly damaging Het
Pcdha11 T A 18: 37,006,020 L234Q probably damaging Het
Pgm3 C T 9: 86,556,362 A457T probably benign Het
Pkp4 T C 2: 59,314,394 V533A probably benign Het
Plac8l1 T C 18: 42,192,637 T68A possibly damaging Het
Pou2f3 A T 9: 43,139,399 I222N probably damaging Het
Ppp1r14d T C 2: 119,229,741 D20G probably benign Het
Ppp1r37 C A 7: 19,531,804 G679V probably damaging Het
Ppp6r2 T A 15: 89,262,396 I199N probably damaging Het
Prune2 A G 19: 17,120,029 T966A probably damaging Het
Ptdss2 T C 7: 141,154,885 V375A probably benign Het
Rara TGCCCCGC TGCCCCGCCCCGC 11: 98,966,410 probably null Het
Rin2 T A 2: 145,878,902 C718* probably null Het
Rptor C T 11: 119,894,287 T1170I probably benign Het
Samd5 T C 10: 9,674,515 Y150C probably damaging Het
Setd1b T C 5: 123,158,710 S1245P unknown Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc29a1 C A 17: 45,586,227 V378L probably damaging Het
Slc2a12 T G 10: 22,665,362 I372S possibly damaging Het
Slc7a10 T A 7: 35,195,214 Y99* probably null Het
Smco3 A G 6: 136,831,519 V119A probably damaging Het
Sptlc3 C T 2: 139,494,234 T10I probably benign Het
Sri T A 5: 8,063,323 W105R probably damaging Het
Stk35 T C 2: 129,810,571 Y331H probably damaging Het
Tipin T C 9: 64,288,148 I12T probably benign Het
Tlr5 A G 1: 182,975,128 T666A probably benign Het
Tmprss11g C A 5: 86,492,144 V222L probably benign Het
Tnfrsf11b T A 15: 54,252,160 Y347F possibly damaging Het
Traf6 A G 2: 101,697,167 T421A probably benign Het
Trrap T A 5: 144,771,239 D30E possibly damaging Het
Ube2k T A 5: 65,594,504 Y162N probably damaging Het
Uck2 A T 1: 167,237,602 V49E probably damaging Het
Vcam1 A T 3: 116,110,943 Y718* probably null Het
Zan T C 5: 137,474,007 N159S probably damaging Het
Zfp438 A G 18: 5,210,788 L750P probably damaging Het
Zfp54 A T 17: 21,433,775 Y177F probably benign Het
Other mutations in Cfap46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00493:Cfap46 APN 7 139614443 missense probably benign 0.06
IGL00505:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00508:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL00514:Cfap46 APN 7 139660689 missense probably damaging 0.96
IGL01394:Cfap46 APN 7 139666979 missense probably damaging 1.00
IGL01621:Cfap46 APN 7 139606607 missense unknown
IGL02171:Cfap46 APN 7 139667056 missense possibly damaging 0.86
IGL02343:Cfap46 APN 7 139682509 missense probably damaging 0.99
IGL02679:Cfap46 APN 7 139614470 missense probably damaging 0.99
IGL02687:Cfap46 APN 7 139607201 missense probably damaging 0.99
IGL03180:Cfap46 APN 7 139603252 missense unknown
IGL03329:Cfap46 APN 7 139601165 missense probably damaging 0.99
FR4449:Cfap46 UTSW 7 139638795 utr 3 prime probably benign
FR4737:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
FR4976:Cfap46 UTSW 7 139638930 utr 3 prime probably benign
PIT4651001:Cfap46 UTSW 7 139645551 missense
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0051:Cfap46 UTSW 7 139676035 missense probably damaging 1.00
R0318:Cfap46 UTSW 7 139654566 missense probably damaging 1.00
R0358:Cfap46 UTSW 7 139651533 splice site probably benign
R0650:Cfap46 UTSW 7 139605655 missense unknown
R0675:Cfap46 UTSW 7 139676034 missense probably damaging 1.00
R0750:Cfap46 UTSW 7 139654670 missense probably damaging 1.00
R0931:Cfap46 UTSW 7 139655841 missense probably damaging 1.00
R1024:Cfap46 UTSW 7 139642597 missense probably benign 0.42
R1251:Cfap46 UTSW 7 139601265 missense probably benign 0.40
R1257:Cfap46 UTSW 7 139654629 nonsense probably null
R1538:Cfap46 UTSW 7 139683008 missense probably null 1.00
R1618:Cfap46 UTSW 7 139652810 missense probably benign 0.04
R1655:Cfap46 UTSW 7 139642520 nonsense probably null
R1824:Cfap46 UTSW 7 139639602 missense probably benign 0.12
R1830:Cfap46 UTSW 7 139640407 missense possibly damaging 0.92
R1857:Cfap46 UTSW 7 139653408 missense probably damaging 1.00
R1870:Cfap46 UTSW 7 139683470 missense probably damaging 1.00
R1945:Cfap46 UTSW 7 139679903 missense probably damaging 1.00
R1962:Cfap46 UTSW 7 139667041 missense probably damaging 1.00
R2108:Cfap46 UTSW 7 139683761 missense probably benign 0.03
R2354:Cfap46 UTSW 7 139661046 missense probably damaging 0.99
R2367:Cfap46 UTSW 7 139653498 missense probably damaging 0.99
R3237:Cfap46 UTSW 7 139617590 missense probably damaging 1.00
R3617:Cfap46 UTSW 7 139639599 missense probably benign 0.06
R3949:Cfap46 UTSW 7 139678551 missense probably benign 0.12
R4239:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4240:Cfap46 UTSW 7 139666287 missense possibly damaging 0.74
R4297:Cfap46 UTSW 7 139652673 missense probably benign 0.27
R4365:Cfap46 UTSW 7 139650952 missense probably damaging 0.99
R4516:Cfap46 UTSW 7 139660082 intron probably benign
R4595:Cfap46 UTSW 7 139652404 missense possibly damaging 0.74
R4627:Cfap46 UTSW 7 139657281 missense probably damaging 0.99
R4627:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4628:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4629:Cfap46 UTSW 7 139680927 missense probably damaging 1.00
R4687:Cfap46 UTSW 7 139627456 missense possibly damaging 0.79
R4750:Cfap46 UTSW 7 139679323 critical splice donor site probably null
R4771:Cfap46 UTSW 7 139630608 missense probably null
R4779:Cfap46 UTSW 7 139659815 intron probably benign
R4812:Cfap46 UTSW 7 139636000 missense probably damaging 1.00
R4974:Cfap46 UTSW 7 139607188 critical splice donor site probably null
R5014:Cfap46 UTSW 7 139627375 missense probably benign 0.12
R5033:Cfap46 UTSW 7 139603860 missense probably benign 0.00
R5055:Cfap46 UTSW 7 139661190 missense probably damaging 1.00
R5254:Cfap46 UTSW 7 139678514 missense possibly damaging 0.77
R5288:Cfap46 UTSW 7 139613507 critical splice donor site probably null
R5366:Cfap46 UTSW 7 139650886 missense probably damaging 1.00
R5368:Cfap46 UTSW 7 139627473 missense possibly damaging 0.77
R5371:Cfap46 UTSW 7 139632181 splice site probably null
R5642:Cfap46 UTSW 7 139678577 missense probably damaging 1.00
R5690:Cfap46 UTSW 7 139638353 missense probably benign 0.01
R5691:Cfap46 UTSW 7 139606700 missense possibly damaging 0.49
R5696:Cfap46 UTSW 7 139612031 missense probably damaging 1.00
R5844:Cfap46 UTSW 7 139650942 missense probably damaging 0.99
R5963:Cfap46 UTSW 7 139651595 missense probably damaging 0.97
R6217:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6228:Cfap46 UTSW 7 139656580 missense probably damaging 1.00
R6251:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6253:Cfap46 UTSW 7 139638900 utr 3 prime probably benign
R6285:Cfap46 UTSW 7 139661085 missense probably damaging 1.00
R6334:Cfap46 UTSW 7 139680831 missense probably damaging 1.00
R6520:Cfap46 UTSW 7 139614405 critical splice donor site probably null
R6736:Cfap46 UTSW 7 139619971 missense possibly damaging 0.92
R6760:Cfap46 UTSW 7 139652440 missense probably damaging 1.00
R6773:Cfap46 UTSW 7 139642561 utr 3 prime probably benign
R6835:Cfap46 UTSW 7 139652498 missense probably damaging 0.98
R6903:Cfap46 UTSW 7 139654561 critical splice donor site probably null
R6912:Cfap46 UTSW 7 139639700 missense probably benign 0.09
R7163:Cfap46 UTSW 7 139618078 critical splice donor site probably null
R7232:Cfap46 UTSW 7 139617577 missense unknown
R7327:Cfap46 UTSW 7 139635146 splice site probably null
R7336:Cfap46 UTSW 7 139620104 missense unknown
R7337:Cfap46 UTSW 7 139630576 critical splice donor site probably null
R7437:Cfap46 UTSW 7 139650837 nonsense probably null
R7450:Cfap46 UTSW 7 139617437 missense unknown
R7495:Cfap46 UTSW 7 139603196 critical splice donor site probably null
R7618:Cfap46 UTSW 7 139603239 missense
R7623:Cfap46 UTSW 7 139618350 missense unknown
R7765:Cfap46 UTSW 7 139651564 missense
R7971:Cfap46 UTSW 7 139635127 missense unknown
R8211:Cfap46 UTSW 7 139633304 missense unknown
R8306:Cfap46 UTSW 7 139656580 missense
R8354:Cfap46 UTSW 7 139653498 missense probably benign 0.03
R8365:Cfap46 UTSW 7 139683084 nonsense probably null
R8447:Cfap46 UTSW 7 139680986 missense possibly damaging 0.90
R8715:Cfap46 UTSW 7 139605644 missense
R8805:Cfap46 UTSW 7 139632063 missense unknown
R8830:Cfap46 UTSW 7 139615649 missense unknown
R8912:Cfap46 UTSW 7 139680181 intron probably benign
R8920:Cfap46 UTSW 7 139652526 missense
R8977:Cfap46 UTSW 7 139679933 missense probably benign 0.01
R9048:Cfap46 UTSW 7 139627343 missense unknown
R9252:Cfap46 UTSW 7 139618249 missense unknown
R9276:Cfap46 UTSW 7 139621291 missense unknown
R9301:Cfap46 UTSW 7 139642545 missense
R9391:Cfap46 UTSW 7 139618111 missense unknown
R9402:Cfap46 UTSW 7 139635949 missense unknown
R9443:Cfap46 UTSW 7 139615107 missense
RF023:Cfap46 UTSW 7 139638918
W0251:Cfap46 UTSW 7 139603946 missense probably benign 0.11
X0018:Cfap46 UTSW 7 139680912 missense probably benign 0.03
X0064:Cfap46 UTSW 7 139603447 missense probably benign 0.01
Z1088:Cfap46 UTSW 7 139635064 missense probably damaging 0.96
Z1176:Cfap46 UTSW 7 139639548 missense
Z1177:Cfap46 UTSW 7 139601267 missense unknown
Z1177:Cfap46 UTSW 7 139630626 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAAGGTCAAATATGGAGGGCC -3'
(R):5'- TTCCCTAAGAAGCATGGGTTGG -3'

Sequencing Primer
(F):5'- GCCACATCCCAGTGCAG -3'
(R):5'- GTTCATTGATTTCAGTCTTCCTTGAG -3'
Posted On 2022-02-07