Incidental Mutation 'R9224:Bsn'

• ID: 699692
• Institutional Source: Beutler Lab
• Gene Symbol: Bsn
• Ensembl Gene: ENSMUSG00000032589
• Gene Name: bassoon
• Synonyms: presynaptic cytomatrix protein
• Accession Numbers:

  Genbank: NM_007567; MGI: 1277955

• Essential gene?: Possibly non essential (E-score: 0.364)
• Stock #: R9224 (G1)
• Quality Score: 225.009
• Status: Not validated
• Chromosome: 9
• Chromosomal Location: 108096022-108190384 bp(-) (GRCm38)
• Type of Mutation: missense
• DNA Base Change (assembly): C to A at 108105487 bp (GRCm38)
• Zygosity: Heterozygous
• Amino Acid Change: Arginine to Leucine at position 917 (R917L)
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000035208]
• AlphaFold: no structure available at present
• Predicted Effect: unknown; Transcript: ENSMUST00000035208; AA Change: R3689L
• SMART Domains: Protein: ENSMUSP00000035208; Gene: ENSMUSG00000032589; AA Change: R3689L

Domain	Start	End	E-Value	Type
low complexity region	4	40	N/A	INTRINSIC
low complexity region	42	77	N/A	INTRINSIC
Pfam:zf-piccolo	165	223	6.1e-30	PFAM
low complexity region	394	409	N/A	INTRINSIC
low complexity region	445	454	N/A	INTRINSIC
Pfam:zf-piccolo	462	520	5.2e-31	PFAM
low complexity region	527	540	N/A	INTRINSIC
low complexity region	627	643	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	694	708	N/A	INTRINSIC
low complexity region	788	803	N/A	INTRINSIC
low complexity region	994	1021	N/A	INTRINSIC
coiled coil region	1047	1101	N/A	INTRINSIC
low complexity region	1131	1145	N/A	INTRINSIC
low complexity region	1173	1190	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1333	1343	N/A	INTRINSIC
low complexity region	1443	1455	N/A	INTRINSIC
low complexity region	1481	1498	N/A	INTRINSIC
low complexity region	1790	1800	N/A	INTRINSIC
low complexity region	2117	2126	N/A	INTRINSIC
low complexity region	2287	2303	N/A	INTRINSIC
low complexity region	2326	2356	N/A	INTRINSIC
SCOP:d1eq1a_	2362	2477	2e-7	SMART
low complexity region	2607	2614	N/A	INTRINSIC
low complexity region	2635	2651	N/A	INTRINSIC
low complexity region	2655	2672	N/A	INTRINSIC
coiled coil region	2949	2990	N/A	INTRINSIC
low complexity region	3057	3071	N/A	INTRINSIC
low complexity region	3089	3114	N/A	INTRINSIC
low complexity region	3446	3461	N/A	INTRINSIC
low complexity region	3520	3534	N/A	INTRINSIC
low complexity region	3653	3666	N/A	INTRINSIC
low complexity region	3750	3820	N/A	INTRINSIC
low complexity region	3831	3852	N/A	INTRINSIC
low complexity region	3856	3901	N/A	INTRINSIC

• Coding Region Coverage:
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008] ; PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
• Allele List at MGI:

  All alleles(9) : Targeted, other(1) Gene trapped(8)

• Posted On: 2022-02-07

Predicted Primers

PCR Primer
(F):5'- ACCTTGCATCTGTGGCTGAG -3'
(R):5'- CAGCTACCATGACTACGATGAG -3'

Sequencing Primer
(F):5'- CTGAGCCTGGGTGTCTGC -3'
(R):5'- ATGACTACGATGAGCCCCCTG -3'