Incidental Mutation 'R9224:Enpp3'
ID 699695
Institutional Source Beutler Lab
Gene Symbol Enpp3
Ensembl Gene ENSMUSG00000019989
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 3
Synonyms CD203c
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R9224 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 24649712-24712093 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24650716 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 807 (V807I)
Ref Sequence ENSEMBL: ENSMUSP00000020169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020169]
AlphaFold Q6DYE8
Predicted Effect probably benign
Transcript: ENSMUST00000020169
AA Change: V807I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020169
Gene: ENSMUSG00000019989
AA Change: V807I

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
SO 50 93 1.99e-13 SMART
SO 94 137 7.66e-15 SMART
Pfam:Phosphodiest 161 485 1.7e-87 PFAM
Blast:Endonuclease_NS 543 599 9e-15 BLAST
Endonuclease_NS 626 847 5.41e-16 SMART
NUC 627 856 1.54e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219861
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a series of ectoenzymes that are involved in hydrolysis of extracellular nucleotides. These ectoenzymes possess ATPase and ATP pyrophosphatase activities and are type II transmembrane proteins. Expression of the related rat mRNA has been found in a subset of immature glial cells and in the alimentary tract. The corresponding rat protein has been detected in the pancreas, small intestine, colon, and liver. The human mRNA is expressed in glioma cells, prostate, and uterus. Expression of the human protein has been detected in uterus, basophils, and mast cells. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit increased numbers of basophils and mast cells with increased susceptibility to chronic allergic responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,767,100 (GRCm39) S229L possibly damaging Het
Actc1 TGA T 2: 113,879,710 (GRCm39) probably null Het
Actl9 G A 17: 33,653,004 (GRCm39) A355T probably benign Het
Adamts8 A G 9: 30,854,188 (GRCm39) Q19R probably benign Het
Akr1c14 A T 13: 4,130,695 (GRCm39) Y216F possibly damaging Het
Alms1 T C 6: 85,598,770 (GRCm39) C1199R possibly damaging Het
Apc2 T C 10: 80,150,111 (GRCm39) S1722P probably damaging Het
Arid1a T C 4: 133,409,167 (GRCm39) E1395G unknown Het
Atp6v0e2 T C 6: 48,516,190 (GRCm39) V46A possibly damaging Het
Bcar3 A G 3: 122,319,091 (GRCm39) R743G probably damaging Het
Bhmt2 A G 13: 93,805,854 (GRCm39) V56A probably damaging Het
Bsn C A 9: 107,982,686 (GRCm39) R917L Het
Cabyr T G 18: 12,887,278 (GRCm39) V303G possibly damaging Het
Carmil1 A T 13: 24,292,512 (GRCm39) I429N probably damaging Het
Ccdc27 T C 4: 154,122,174 (GRCm39) N235D unknown Het
Ccdc61 T C 7: 18,637,746 (GRCm39) M37V probably benign Het
Cd40 A T 2: 164,898,716 (GRCm39) I48F unknown Het
Cdk13 A T 13: 17,941,071 (GRCm39) S664R probably damaging Het
Cel TTA TTATA 2: 28,449,441 (GRCm39) probably null Het
Cfap46 T A 7: 139,258,416 (GRCm39) R286* probably null Het
Ckap2 A C 8: 22,659,954 (GRCm39) I509S possibly damaging Het
Clptm1l A T 13: 73,752,344 (GRCm39) probably benign Het
Col11a1 T G 3: 114,001,929 (GRCm39) M1591R unknown Het
Col6a5 C A 9: 105,814,594 (GRCm39) A473S unknown Het
Cxcr2 T A 1: 74,197,756 (GRCm39) D83E probably damaging Het
Cyp2c39 G A 19: 39,527,332 (GRCm39) C226Y probably benign Het
Ddr1 A C 17: 36,000,609 (GRCm39) F352C probably damaging Het
Defb22 T A 2: 152,327,721 (GRCm39) T155S unknown Het
Dennd4c G T 4: 86,738,170 (GRCm39) E935* probably null Het
Dst A C 1: 34,330,879 (GRCm39) E4889D probably damaging Het
Efcab3 A G 11: 104,661,801 (GRCm39) Q1314R probably benign Het
Emilin1 T A 5: 31,074,823 (GRCm39) C355S probably damaging Het
Fcnb T A 2: 27,969,160 (GRCm39) D179V probably damaging Het
Ficd T A 5: 113,875,196 (GRCm39) D88E probably benign Het
Fndc3b T C 3: 27,524,450 (GRCm39) K437E possibly damaging Het
Fyb2 T A 4: 104,853,105 (GRCm39) W566R probably benign Het
Gm14403 A G 2: 177,200,336 (GRCm39) Q94R probably benign Het
Gm32687 T A 10: 81,714,866 (GRCm39) I86N probably benign Het
Gpam T G 19: 55,075,907 (GRCm39) D235A probably damaging Het
Gstt4 T C 10: 75,651,046 (GRCm39) E192G probably damaging Het
H2-Q6 T G 17: 35,644,309 (GRCm39) V97G probably benign Het
Hcn1 G A 13: 118,062,254 (GRCm39) G507S unknown Het
Hydin T C 8: 111,259,516 (GRCm39) I2496T probably benign Het
Jund A G 8: 71,151,864 (GRCm39) D53G probably damaging Het
Kat6b T A 14: 21,720,031 (GRCm39) M1461K probably benign Het
Lnx1 T G 5: 74,766,810 (GRCm39) K435Q probably benign Het
Lpcat1 C A 13: 73,658,161 (GRCm39) L316M probably damaging Het
Lrrtm3 ATTTT ATTTTT 10: 63,925,035 (GRCm39) probably null Het
Ly6c1 T A 15: 74,916,465 (GRCm39) T126S probably benign Het
Macf1 A G 4: 123,326,690 (GRCm39) S4938P probably damaging Het
Map2k2 T C 10: 80,954,008 (GRCm39) V158A possibly damaging Het
Map3k4 A G 17: 12,456,973 (GRCm39) V1323A probably damaging Het
Map4k5 A T 12: 69,939,467 (GRCm39) V23E possibly damaging Het
Med30 T G 15: 52,582,839 (GRCm39) L92R probably damaging Het
Mroh8 C T 2: 157,063,069 (GRCm39) G851S possibly damaging Het
Msmb T A 14: 31,880,060 (GRCm39) C83* probably null Het
Mtif2 A T 11: 29,494,364 (GRCm39) R655S probably benign Het
Myo10 C T 15: 25,808,081 (GRCm39) S1901L probably benign Het
Myom2 A T 8: 15,178,804 (GRCm39) I1279F possibly damaging Het
Nat9 T C 11: 115,075,441 (GRCm39) I67V probably damaging Het
Ncam1 A G 9: 49,419,995 (GRCm39) S774P probably damaging Het
Ndufaf6 T C 4: 11,062,089 (GRCm39) T181A probably damaging Het
Nlrp4f T A 13: 65,332,829 (GRCm39) K110* probably null Het
Nlrp9b T C 7: 19,753,217 (GRCm39) S41P probably benign Het
Nlrp9b A G 7: 19,757,476 (GRCm39) T238A probably benign Het
Noxo1 A T 17: 24,919,305 (GRCm39) E342D probably benign Het
Nt5dc2 T C 14: 30,857,665 (GRCm39) M55T probably benign Het
Or1j14 A T 2: 36,417,838 (GRCm39) Q138L probably benign Het
Or2ag18 T C 7: 106,405,489 (GRCm39) Y60C probably damaging Het
Or2f1 T C 6: 42,721,904 (GRCm39) F311S probably benign Het
Or2h2c T C 17: 37,422,767 (GRCm39) T36A possibly damaging Het
Or5al6 T A 2: 85,976,220 (GRCm39) N286I probably damaging Het
Or6c210 C A 10: 129,496,007 (GRCm39) L111M probably damaging Het
Or6c6 T A 10: 129,186,450 (GRCm39) M6K probably benign Het
Or9s18 C T 13: 65,300,203 (GRCm39) T55I probably damaging Het
P4ha2 C T 11: 54,009,963 (GRCm39) P240L possibly damaging Het
Pcdha11 T A 18: 37,139,073 (GRCm39) L234Q probably damaging Het
Pgm3 C T 9: 86,438,415 (GRCm39) A457T probably benign Het
Pira12 T C 7: 3,900,234 (GRCm39) T123A probably benign Het
Pkp4 T C 2: 59,144,738 (GRCm39) V533A probably benign Het
Plac8l1 T C 18: 42,325,702 (GRCm39) T68A possibly damaging Het
Pou2f3 A T 9: 43,050,694 (GRCm39) I222N probably damaging Het
Ppp1r14d T C 2: 119,060,222 (GRCm39) D20G probably benign Het
Ppp1r37 C A 7: 19,265,729 (GRCm39) G679V probably damaging Het
Ppp6r2 T A 15: 89,146,599 (GRCm39) I199N probably damaging Het
Prune2 A G 19: 17,097,393 (GRCm39) T966A probably damaging Het
Ptdss2 T C 7: 140,734,798 (GRCm39) V375A probably benign Het
Rara TGCCCCGC TGCCCCGCCCCGC 11: 98,857,236 (GRCm39) probably null Het
Rin2 T A 2: 145,720,822 (GRCm39) C718* probably null Het
Rptor C T 11: 119,785,113 (GRCm39) T1170I probably benign Het
Samd5 T C 10: 9,550,259 (GRCm39) Y150C probably damaging Het
Setd1b T C 5: 123,296,773 (GRCm39) S1245P unknown Het
Sipa1l2 T C 8: 126,218,716 (GRCm39) E207G probably damaging Het
Slc29a1 C A 17: 45,897,153 (GRCm39) V378L probably damaging Het
Slc2a12 T G 10: 22,541,261 (GRCm39) I372S possibly damaging Het
Slc7a10 T A 7: 34,894,639 (GRCm39) Y99* probably null Het
Smco3 A G 6: 136,808,517 (GRCm39) V119A probably damaging Het
Sptlc3 C T 2: 139,336,154 (GRCm39) T10I probably benign Het
Sri T A 5: 8,113,323 (GRCm39) W105R probably damaging Het
Stk35 T C 2: 129,652,491 (GRCm39) Y331H probably damaging Het
Tipin T C 9: 64,195,430 (GRCm39) I12T probably benign Het
Tlr5 A G 1: 182,802,693 (GRCm39) T666A probably benign Het
Tmprss11g C A 5: 86,640,003 (GRCm39) V222L probably benign Het
Tnfrsf11b T A 15: 54,115,556 (GRCm39) Y347F possibly damaging Het
Traf6 A G 2: 101,527,512 (GRCm39) T421A probably benign Het
Trrap T A 5: 144,708,049 (GRCm39) D30E possibly damaging Het
Ube2k T A 5: 65,751,847 (GRCm39) Y162N probably damaging Het
Uck2 A T 1: 167,065,171 (GRCm39) V49E probably damaging Het
Vcam1 A T 3: 115,904,592 (GRCm39) Y718* probably null Het
Zan T C 5: 137,472,269 (GRCm39) N159S probably damaging Het
Zfp438 A G 18: 5,210,788 (GRCm39) L750P probably damaging Het
Zfp54 A T 17: 21,654,037 (GRCm39) Y177F probably benign Het
Other mutations in Enpp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Enpp3 APN 10 24,663,670 (GRCm39) missense probably benign 0.00
IGL00778:Enpp3 APN 10 24,674,160 (GRCm39) missense probably damaging 1.00
IGL01147:Enpp3 APN 10 24,650,805 (GRCm39) missense probably damaging 1.00
IGL01343:Enpp3 APN 10 24,681,820 (GRCm39) nonsense probably null
IGL01642:Enpp3 APN 10 24,674,167 (GRCm39) missense probably damaging 1.00
IGL01814:Enpp3 APN 10 24,667,923 (GRCm39) missense possibly damaging 0.68
IGL02083:Enpp3 APN 10 24,652,692 (GRCm39) missense probably damaging 1.00
IGL02152:Enpp3 APN 10 24,649,900 (GRCm39) missense probably damaging 1.00
IGL02186:Enpp3 APN 10 24,667,881 (GRCm39) splice site probably benign
IGL02517:Enpp3 APN 10 24,685,746 (GRCm39) splice site probably benign
IGL02956:Enpp3 APN 10 24,650,841 (GRCm39) splice site probably benign
R0017:Enpp3 UTSW 10 24,675,051 (GRCm39) splice site probably null
R0042:Enpp3 UTSW 10 24,650,722 (GRCm39) missense probably damaging 1.00
R0110:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0218:Enpp3 UTSW 10 24,652,767 (GRCm39) missense possibly damaging 0.80
R0403:Enpp3 UTSW 10 24,680,334 (GRCm39) missense probably damaging 1.00
R0433:Enpp3 UTSW 10 24,696,495 (GRCm39) missense probably benign 0.00
R0450:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0510:Enpp3 UTSW 10 24,652,679 (GRCm39) missense probably damaging 1.00
R0826:Enpp3 UTSW 10 24,671,614 (GRCm39) missense probably damaging 1.00
R1245:Enpp3 UTSW 10 24,660,851 (GRCm39) splice site probably benign
R1261:Enpp3 UTSW 10 24,650,832 (GRCm39) missense probably damaging 0.97
R1633:Enpp3 UTSW 10 24,671,680 (GRCm39) missense probably damaging 1.00
R1903:Enpp3 UTSW 10 24,654,687 (GRCm39) missense probably damaging 1.00
R1913:Enpp3 UTSW 10 24,652,669 (GRCm39) nonsense probably null
R1966:Enpp3 UTSW 10 24,683,389 (GRCm39) missense probably damaging 0.99
R2157:Enpp3 UTSW 10 24,652,776 (GRCm39) missense probably damaging 1.00
R2179:Enpp3 UTSW 10 24,681,793 (GRCm39) missense probably benign 0.00
R2380:Enpp3 UTSW 10 24,652,770 (GRCm39) missense probably benign
R2410:Enpp3 UTSW 10 24,650,716 (GRCm39) missense probably benign 0.00
R3794:Enpp3 UTSW 10 24,707,630 (GRCm39) splice site probably null
R3896:Enpp3 UTSW 10 24,653,847 (GRCm39) missense possibly damaging 0.79
R4334:Enpp3 UTSW 10 24,669,487 (GRCm39) missense probably damaging 1.00
R4569:Enpp3 UTSW 10 24,652,780 (GRCm39) missense probably damaging 1.00
R4766:Enpp3 UTSW 10 24,649,825 (GRCm39) missense probably damaging 1.00
R4951:Enpp3 UTSW 10 24,674,175 (GRCm39) missense probably damaging 1.00
R4998:Enpp3 UTSW 10 24,683,436 (GRCm39) missense probably benign 0.01
R5045:Enpp3 UTSW 10 24,652,665 (GRCm39) missense probably damaging 1.00
R5276:Enpp3 UTSW 10 24,685,814 (GRCm39) missense probably damaging 1.00
R5331:Enpp3 UTSW 10 24,684,058 (GRCm39) missense probably damaging 1.00
R5569:Enpp3 UTSW 10 24,654,719 (GRCm39) missense probably damaging 0.98
R5975:Enpp3 UTSW 10 24,650,740 (GRCm39) missense probably benign 0.37
R6117:Enpp3 UTSW 10 24,663,750 (GRCm39) missense probably damaging 1.00
R6419:Enpp3 UTSW 10 24,684,089 (GRCm39) missense probably damaging 1.00
R6677:Enpp3 UTSW 10 24,653,855 (GRCm39) missense possibly damaging 0.88
R6735:Enpp3 UTSW 10 24,683,351 (GRCm39) missense probably damaging 1.00
R6833:Enpp3 UTSW 10 24,685,768 (GRCm39) missense probably damaging 1.00
R6999:Enpp3 UTSW 10 24,684,064 (GRCm39) missense probably damaging 1.00
R7022:Enpp3 UTSW 10 24,702,093 (GRCm39) missense probably damaging 0.99
R7173:Enpp3 UTSW 10 24,649,945 (GRCm39) missense probably damaging 1.00
R7224:Enpp3 UTSW 10 24,652,782 (GRCm39) missense possibly damaging 0.63
R7227:Enpp3 UTSW 10 24,693,742 (GRCm39) missense unknown
R7487:Enpp3 UTSW 10 24,681,821 (GRCm39) missense probably benign 0.02
R7529:Enpp3 UTSW 10 24,674,072 (GRCm39) missense probably damaging 0.97
R7583:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R7692:Enpp3 UTSW 10 24,660,739 (GRCm39) nonsense probably null
R7962:Enpp3 UTSW 10 24,660,752 (GRCm39) missense probably damaging 1.00
R7965:Enpp3 UTSW 10 24,654,717 (GRCm39) missense possibly damaging 0.90
R8153:Enpp3 UTSW 10 24,685,777 (GRCm39) missense probably damaging 1.00
R8262:Enpp3 UTSW 10 24,653,824 (GRCm39) missense probably damaging 1.00
R8305:Enpp3 UTSW 10 24,700,827 (GRCm39) critical splice acceptor site probably null
R8393:Enpp3 UTSW 10 24,702,139 (GRCm39) missense probably damaging 1.00
R8776:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8776-TAIL:Enpp3 UTSW 10 24,650,733 (GRCm39) missense probably damaging 1.00
R8962:Enpp3 UTSW 10 24,696,513 (GRCm39) missense probably benign 0.12
R9047:Enpp3 UTSW 10 24,674,172 (GRCm39) missense possibly damaging 0.83
R9093:Enpp3 UTSW 10 24,671,702 (GRCm39) missense probably benign 0.00
R9117:Enpp3 UTSW 10 24,702,078 (GRCm39) missense possibly damaging 0.67
R9194:Enpp3 UTSW 10 24,675,092 (GRCm39) missense possibly damaging 0.90
R9244:Enpp3 UTSW 10 24,654,689 (GRCm39) missense probably damaging 1.00
R9387:Enpp3 UTSW 10 24,711,990 (GRCm39) start codon destroyed probably null 0.83
R9644:Enpp3 UTSW 10 24,685,801 (GRCm39) missense probably damaging 0.98
R9658:Enpp3 UTSW 10 24,649,802 (GRCm39) makesense probably null
X0026:Enpp3 UTSW 10 24,702,140 (GRCm39) missense probably damaging 1.00
Z1176:Enpp3 UTSW 10 24,663,691 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTACATATGCAGATGCGCG -3'
(R):5'- TGCCATTTCCTTAATGCCAAG -3'

Sequencing Primer
(F):5'- GCAGATGCGCGTTTAATATTAATTC -3'
(R):5'- ATGCCAAGCTATAAAACAAAAAGAC -3'
Posted On 2022-02-07