Incidental Mutation 'R9224:Clptm1l'
ID 699716
Institutional Source Beutler Lab
Gene Symbol Clptm1l
Ensembl Gene ENSMUSG00000021610
Gene Name CLPTM1-like
Synonyms C130052I12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9224 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 73604006-73620605 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) A to T at 73604225 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022102]
AlphaFold Q8BXA5
Predicted Effect probably benign
Transcript: ENSMUST00000022102
SMART Domains Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610

DomainStartEndE-ValueType
Pfam:CLPTM1 10 423 3.2e-134 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,100 S229L possibly damaging Het
Actc1 TGA T 2: 114,049,229 probably null Het
Actl9 G A 17: 33,434,030 A355T probably benign Het
Adamts8 A G 9: 30,942,892 Q19R probably benign Het
Akr1c14 A T 13: 4,080,695 Y216F possibly damaging Het
Alms1 T C 6: 85,621,788 C1199R possibly damaging Het
Apc2 T C 10: 80,314,277 S1722P probably damaging Het
Arid1a T C 4: 133,681,856 E1395G unknown Het
Atp6v0e2 T C 6: 48,539,256 V46A possibly damaging Het
Bcar3 A G 3: 122,525,442 R743G probably damaging Het
Bhmt2 A G 13: 93,669,346 V56A probably damaging Het
Bsn C A 9: 108,105,487 R917L Het
Cabyr T G 18: 12,754,221 V303G possibly damaging Het
Carmil1 A T 13: 24,108,529 I429N probably damaging Het
Ccdc27 T C 4: 154,037,717 N235D unknown Het
Ccdc61 T C 7: 18,903,821 M37V probably benign Het
Cd40 A T 2: 165,056,796 I48F unknown Het
Cdk13 A T 13: 17,766,486 S664R probably damaging Het
Cel TTA TTATA 2: 28,559,429 probably null Het
Cfap46 T A 7: 139,678,500 R286* probably null Het
Ckap2 A C 8: 22,169,938 I509S possibly damaging Het
Col11a1 T G 3: 114,208,280 M1591R unknown Het
Col6a5 C A 9: 105,937,395 A473S unknown Het
Cxcr2 T A 1: 74,158,597 D83E probably damaging Het
Cyp2c39 G A 19: 39,538,888 C226Y probably benign Het
Ddr1 A C 17: 35,689,717 F352C probably damaging Het
Defb22 T A 2: 152,485,801 T155S unknown Het
Dennd4c G T 4: 86,819,933 E935* probably null Het
Dst A C 1: 34,291,798 E4889D probably damaging Het
Emilin1 T A 5: 30,917,479 C355S probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Fcnb T A 2: 28,079,148 D179V probably damaging Het
Ficd T A 5: 113,737,135 D88E probably benign Het
Fndc3b T C 3: 27,470,301 K437E possibly damaging Het
Fyb2 T A 4: 104,995,908 W566R probably benign Het
Gm11639 A G 11: 104,770,975 Q1314R probably benign Het
Gm14403 A G 2: 177,508,543 Q94R probably benign Het
Gm14548 T C 7: 3,897,235 T123A probably benign Het
Gm32687 T A 10: 81,879,032 I86N probably benign Het
Gpam T G 19: 55,087,475 D235A probably damaging Het
Gstt4 T C 10: 75,815,212 E192G probably damaging Het
H2-Q6 T G 17: 35,425,333 V97G probably benign Het
Hcn1 G A 13: 117,925,718 G507S unknown Het
Hydin T C 8: 110,532,884 I2496T probably benign Het
Jund A G 8: 70,699,215 D53G probably damaging Het
Kat6b T A 14: 21,669,963 M1461K probably benign Het
Lnx1 T G 5: 74,606,149 K435Q probably benign Het
Lpcat1 C A 13: 73,510,042 L316M probably damaging Het
Lrrtm3 ATTTT ATTTTT 10: 64,089,256 probably null Het
Ly6c1 T A 15: 75,044,616 T126S probably benign Het
Macf1 A G 4: 123,432,897 S4938P probably damaging Het
Map2k2 T C 10: 81,118,174 V158A possibly damaging Het
Map3k4 A G 17: 12,238,086 V1323A probably damaging Het
Map4k5 A T 12: 69,892,693 V23E possibly damaging Het
Med30 T G 15: 52,719,443 L92R probably damaging Het
Mroh8 C T 2: 157,221,149 G851S possibly damaging Het
Msmb T A 14: 32,158,103 C83* probably null Het
Mtif2 A T 11: 29,544,364 R655S probably benign Het
Myo10 C T 15: 25,807,995 S1901L probably benign Het
Myom2 A T 8: 15,128,804 I1279F possibly damaging Het
Nat9 T C 11: 115,184,615 I67V probably damaging Het
Ncam1 A G 9: 49,508,695 S774P probably damaging Het
Ndufaf6 T C 4: 11,062,089 T181A probably damaging Het
Nlrp4f T A 13: 65,185,015 K110* probably null Het
Nlrp9b T C 7: 20,019,292 S41P probably benign Het
Nlrp9b A G 7: 20,023,551 T238A probably benign Het
Noxo1 A T 17: 24,700,331 E342D probably benign Het
Nt5dc2 T C 14: 31,135,708 M55T probably benign Het
Olfr1040 T A 2: 86,145,876 N286I probably damaging Het
Olfr342 A T 2: 36,527,826 Q138L probably benign Het
Olfr453 T C 6: 42,744,970 F311S probably benign Het
Olfr466 C T 13: 65,152,389 T55I probably damaging Het
Olfr700 T C 7: 106,806,282 Y60C probably damaging Het
Olfr782 T A 10: 129,350,581 M6K probably benign Het
Olfr800 C A 10: 129,660,138 L111M probably damaging Het
Olfr92 T C 17: 37,111,875 T36A possibly damaging Het
P4ha2 C T 11: 54,119,137 P240L possibly damaging Het
Pcdha11 T A 18: 37,006,020 L234Q probably damaging Het
Pgm3 C T 9: 86,556,362 A457T probably benign Het
Pkp4 T C 2: 59,314,394 V533A probably benign Het
Plac8l1 T C 18: 42,192,637 T68A possibly damaging Het
Pou2f3 A T 9: 43,139,399 I222N probably damaging Het
Ppp1r14d T C 2: 119,229,741 D20G probably benign Het
Ppp1r37 C A 7: 19,531,804 G679V probably damaging Het
Ppp6r2 T A 15: 89,262,396 I199N probably damaging Het
Prune2 A G 19: 17,120,029 T966A probably damaging Het
Ptdss2 T C 7: 141,154,885 V375A probably benign Het
Rara TGCCCCGC TGCCCCGCCCCGC 11: 98,966,410 probably null Het
Rin2 T A 2: 145,878,902 C718* probably null Het
Rptor C T 11: 119,894,287 T1170I probably benign Het
Samd5 T C 10: 9,674,515 Y150C probably damaging Het
Setd1b T C 5: 123,158,710 S1245P unknown Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc29a1 C A 17: 45,586,227 V378L probably damaging Het
Slc2a12 T G 10: 22,665,362 I372S possibly damaging Het
Slc7a10 T A 7: 35,195,214 Y99* probably null Het
Smco3 A G 6: 136,831,519 V119A probably damaging Het
Sptlc3 C T 2: 139,494,234 T10I probably benign Het
Sri T A 5: 8,063,323 W105R probably damaging Het
Stk35 T C 2: 129,810,571 Y331H probably damaging Het
Tipin T C 9: 64,288,148 I12T probably benign Het
Tlr5 A G 1: 182,975,128 T666A probably benign Het
Tmprss11g C A 5: 86,492,144 V222L probably benign Het
Tnfrsf11b T A 15: 54,252,160 Y347F possibly damaging Het
Traf6 A G 2: 101,697,167 T421A probably benign Het
Trrap T A 5: 144,771,239 D30E possibly damaging Het
Ube2k T A 5: 65,594,504 Y162N probably damaging Het
Uck2 A T 1: 167,237,602 V49E probably damaging Het
Vcam1 A T 3: 116,110,943 Y718* probably null Het
Zan T C 5: 137,474,007 N159S probably damaging Het
Zfp438 A G 18: 5,210,788 L750P probably damaging Het
Zfp54 A T 17: 21,433,775 Y177F probably benign Het
Other mutations in Clptm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Clptm1l APN 13 73607873 splice site probably null
IGL01963:Clptm1l APN 13 73617569 splice site probably benign
IGL02169:Clptm1l APN 13 73611663 missense probably damaging 0.96
IGL02554:Clptm1l APN 13 73607760 missense probably benign 0.07
IGL02596:Clptm1l APN 13 73613666 missense probably benign 0.02
IGL02720:Clptm1l APN 13 73614602 splice site probably benign
IGL03100:Clptm1l APN 13 73612390 splice site probably benign
P0023:Clptm1l UTSW 13 73604952 missense possibly damaging 0.67
R0308:Clptm1l UTSW 13 73611667 missense possibly damaging 0.67
R0725:Clptm1l UTSW 13 73606343 missense probably benign
R1572:Clptm1l UTSW 13 73607747 missense probably benign
R1589:Clptm1l UTSW 13 73614673 critical splice donor site probably null
R2062:Clptm1l UTSW 13 73607723 nonsense probably null
R2064:Clptm1l UTSW 13 73607723 nonsense probably null
R2065:Clptm1l UTSW 13 73607723 nonsense probably null
R2067:Clptm1l UTSW 13 73607723 nonsense probably null
R2068:Clptm1l UTSW 13 73607723 nonsense probably null
R3003:Clptm1l UTSW 13 73617756 missense possibly damaging 0.51
R3712:Clptm1l UTSW 13 73616038 missense probably benign 0.21
R3808:Clptm1l UTSW 13 73612454 missense probably benign 0.13
R3966:Clptm1l UTSW 13 73615972 missense probably damaging 1.00
R4615:Clptm1l UTSW 13 73607738 nonsense probably null
R4801:Clptm1l UTSW 13 73607862 missense possibly damaging 0.81
R4802:Clptm1l UTSW 13 73607862 missense possibly damaging 0.81
R4957:Clptm1l UTSW 13 73611196 missense possibly damaging 0.52
R4957:Clptm1l UTSW 13 73612428 missense probably damaging 1.00
R5864:Clptm1l UTSW 13 73606284 missense probably damaging 0.99
R6502:Clptm1l UTSW 13 73617765 critical splice donor site probably null
R6701:Clptm1l UTSW 13 73608906 missense probably benign 0.00
R6720:Clptm1l UTSW 13 73618516 missense probably damaging 1.00
R7782:Clptm1l UTSW 13 73604320 missense probably damaging 1.00
R8292:Clptm1l UTSW 13 73617735 missense probably damaging 0.96
R8329:Clptm1l UTSW 13 73612428 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCCAAGAACCGGGTGCC -3'
(R):5'- ACCAGAACATTGGACAGTGAC -3'

Sequencing Primer
(F):5'- AAGAGGCTGACGTCACGC -3'
(R):5'- GACGCTCACCTGCAGTTTG -3'
Posted On 2022-02-07