Incidental Mutation 'R9224:Cabyr'
ID 699736
Institutional Source Beutler Lab
Gene Symbol Cabyr
Ensembl Gene ENSMUSG00000024430
Gene Name calcium-binding tyrosine-(Y)-phosphorylation regulated (fibrousheathin 2)
Synonyms FSP-2, 4933421A18Rik, CBP86, 1700016C01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9224 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 12741324-12755146 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 12754221 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 303 (V303G)
Ref Sequence ENSEMBL: ENSMUSP00000113131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074352] [ENSMUST00000080415] [ENSMUST00000115857] [ENSMUST00000117361] [ENSMUST00000118313] [ENSMUST00000119043] [ENSMUST00000119108] [ENSMUST00000119512] [ENSMUST00000121018] [ENSMUST00000121774] [ENSMUST00000121808] [ENSMUST00000121888] [ENSMUST00000150758] [ENSMUST00000186263] [ENSMUST00000191078]
AlphaFold Q9D424
Predicted Effect probably benign
Transcript: ENSMUST00000074352
SMART Domains Protein: ENSMUSP00000073957
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
ANK 47 76 2.05e-6 SMART
ANK 80 109 1.29e-3 SMART
low complexity region 141 153 N/A INTRINSIC
ANK 175 204 1.31e-4 SMART
PH 236 336 6.02e-8 SMART
low complexity region 345 354 N/A INTRINSIC
coiled coil region 430 463 N/A INTRINSIC
Pfam:Oxysterol_BP 548 940 6.7e-149 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080415
SMART Domains Protein: ENSMUSP00000079277
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115857
SMART Domains Protein: ENSMUSP00000111523
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.2e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117361
SMART Domains Protein: ENSMUSP00000112681
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118313
SMART Domains Protein: ENSMUSP00000113735
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119043
SMART Domains Protein: ENSMUSP00000113357
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119108
SMART Domains Protein: ENSMUSP00000113760
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 8.5e-13 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119512
SMART Domains Protein: ENSMUSP00000113914
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
coiled coil region 38 71 N/A INTRINSIC
Pfam:Oxysterol_BP 156 549 1.2e-149 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121018
AA Change: V303G

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113131
Gene: ENSMUSG00000024430
AA Change: V303G

DomainStartEndE-ValueType
Pfam:RIIa 12 46 6.7e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
low complexity region 213 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121774
SMART Domains Protein: ENSMUSP00000113268
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 8 401 4e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121808
SMART Domains Protein: ENSMUSP00000113841
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121888
SMART Domains Protein: ENSMUSP00000112895
Gene: ENSMUSG00000044252

DomainStartEndE-ValueType
Pfam:Oxysterol_BP 35 428 5.1e-150 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150758
SMART Domains Protein: ENSMUSP00000118330
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186263
SMART Domains Protein: ENSMUSP00000140870
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191078
SMART Domains Protein: ENSMUSP00000140894
Gene: ENSMUSG00000024430

DomainStartEndE-ValueType
Pfam:RIIa 12 46 2.3e-12 PFAM
low complexity region 77 96 N/A INTRINSIC
low complexity region 141 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] To reach fertilization competence, spermatozoa undergo a series of morphological and molecular maturational processes, termed capacitation, involving protein tyrosine phosphorylation and increased intracellular calcium. The protein encoded by this gene localizes to the principal piece of the sperm flagellum in association with the fibrous sheath and exhibits calcium-binding when phosphorylated during capacitation. A pseudogene on chromosome 3 has been identified for this gene. Alternatively spliced transcript variants encoding distinct protein isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous knockout affects sperm flagellum morphology, resulting in reduced sperm motility. These mutant males are subfertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik C T 19: 3,717,100 S229L possibly damaging Het
Actc1 TGA T 2: 114,049,229 probably null Het
Actl9 G A 17: 33,434,030 A355T probably benign Het
Adamts8 A G 9: 30,942,892 Q19R probably benign Het
Akr1c14 A T 13: 4,080,695 Y216F possibly damaging Het
Alms1 T C 6: 85,621,788 C1199R possibly damaging Het
Apc2 T C 10: 80,314,277 S1722P probably damaging Het
Arid1a T C 4: 133,681,856 E1395G unknown Het
Atp6v0e2 T C 6: 48,539,256 V46A possibly damaging Het
Bcar3 A G 3: 122,525,442 R743G probably damaging Het
Bhmt2 A G 13: 93,669,346 V56A probably damaging Het
Bsn C A 9: 108,105,487 R917L Het
Carmil1 A T 13: 24,108,529 I429N probably damaging Het
Ccdc27 T C 4: 154,037,717 N235D unknown Het
Ccdc61 T C 7: 18,903,821 M37V probably benign Het
Cd40 A T 2: 165,056,796 I48F unknown Het
Cdk13 A T 13: 17,766,486 S664R probably damaging Het
Cel TTA TTATA 2: 28,559,429 probably null Het
Cfap46 T A 7: 139,678,500 R286* probably null Het
Ckap2 A C 8: 22,169,938 I509S possibly damaging Het
Clptm1l A T 13: 73,604,225 probably benign Het
Col11a1 T G 3: 114,208,280 M1591R unknown Het
Col6a5 C A 9: 105,937,395 A473S unknown Het
Cxcr2 T A 1: 74,158,597 D83E probably damaging Het
Cyp2c39 G A 19: 39,538,888 C226Y probably benign Het
Ddr1 A C 17: 35,689,717 F352C probably damaging Het
Defb22 T A 2: 152,485,801 T155S unknown Het
Dennd4c G T 4: 86,819,933 E935* probably null Het
Dst A C 1: 34,291,798 E4889D probably damaging Het
Emilin1 T A 5: 30,917,479 C355S probably damaging Het
Enpp3 C T 10: 24,774,818 V807I probably benign Het
Fcnb T A 2: 28,079,148 D179V probably damaging Het
Ficd T A 5: 113,737,135 D88E probably benign Het
Fndc3b T C 3: 27,470,301 K437E possibly damaging Het
Fyb2 T A 4: 104,995,908 W566R probably benign Het
Gm11639 A G 11: 104,770,975 Q1314R probably benign Het
Gm14403 A G 2: 177,508,543 Q94R probably benign Het
Gm14548 T C 7: 3,897,235 T123A probably benign Het
Gm32687 T A 10: 81,879,032 I86N probably benign Het
Gpam T G 19: 55,087,475 D235A probably damaging Het
Gstt4 T C 10: 75,815,212 E192G probably damaging Het
H2-Q6 T G 17: 35,425,333 V97G probably benign Het
Hcn1 G A 13: 117,925,718 G507S unknown Het
Hydin T C 8: 110,532,884 I2496T probably benign Het
Jund A G 8: 70,699,215 D53G probably damaging Het
Kat6b T A 14: 21,669,963 M1461K probably benign Het
Lnx1 T G 5: 74,606,149 K435Q probably benign Het
Lpcat1 C A 13: 73,510,042 L316M probably damaging Het
Lrrtm3 ATTTT ATTTTT 10: 64,089,256 probably null Het
Ly6c1 T A 15: 75,044,616 T126S probably benign Het
Macf1 A G 4: 123,432,897 S4938P probably damaging Het
Map2k2 T C 10: 81,118,174 V158A possibly damaging Het
Map3k4 A G 17: 12,238,086 V1323A probably damaging Het
Map4k5 A T 12: 69,892,693 V23E possibly damaging Het
Med30 T G 15: 52,719,443 L92R probably damaging Het
Mroh8 C T 2: 157,221,149 G851S possibly damaging Het
Msmb T A 14: 32,158,103 C83* probably null Het
Mtif2 A T 11: 29,544,364 R655S probably benign Het
Myo10 C T 15: 25,807,995 S1901L probably benign Het
Myom2 A T 8: 15,128,804 I1279F possibly damaging Het
Nat9 T C 11: 115,184,615 I67V probably damaging Het
Ncam1 A G 9: 49,508,695 S774P probably damaging Het
Ndufaf6 T C 4: 11,062,089 T181A probably damaging Het
Nlrp4f T A 13: 65,185,015 K110* probably null Het
Nlrp9b T C 7: 20,019,292 S41P probably benign Het
Nlrp9b A G 7: 20,023,551 T238A probably benign Het
Noxo1 A T 17: 24,700,331 E342D probably benign Het
Nt5dc2 T C 14: 31,135,708 M55T probably benign Het
Olfr1040 T A 2: 86,145,876 N286I probably damaging Het
Olfr342 A T 2: 36,527,826 Q138L probably benign Het
Olfr453 T C 6: 42,744,970 F311S probably benign Het
Olfr466 C T 13: 65,152,389 T55I probably damaging Het
Olfr700 T C 7: 106,806,282 Y60C probably damaging Het
Olfr782 T A 10: 129,350,581 M6K probably benign Het
Olfr800 C A 10: 129,660,138 L111M probably damaging Het
Olfr92 T C 17: 37,111,875 T36A possibly damaging Het
P4ha2 C T 11: 54,119,137 P240L possibly damaging Het
Pcdha11 T A 18: 37,006,020 L234Q probably damaging Het
Pgm3 C T 9: 86,556,362 A457T probably benign Het
Pkp4 T C 2: 59,314,394 V533A probably benign Het
Plac8l1 T C 18: 42,192,637 T68A possibly damaging Het
Pou2f3 A T 9: 43,139,399 I222N probably damaging Het
Ppp1r14d T C 2: 119,229,741 D20G probably benign Het
Ppp1r37 C A 7: 19,531,804 G679V probably damaging Het
Ppp6r2 T A 15: 89,262,396 I199N probably damaging Het
Prune2 A G 19: 17,120,029 T966A probably damaging Het
Ptdss2 T C 7: 141,154,885 V375A probably benign Het
Rara TGCCCCGC TGCCCCGCCCCGC 11: 98,966,410 probably null Het
Rin2 T A 2: 145,878,902 C718* probably null Het
Rptor C T 11: 119,894,287 T1170I probably benign Het
Samd5 T C 10: 9,674,515 Y150C probably damaging Het
Setd1b T C 5: 123,158,710 S1245P unknown Het
Sipa1l2 T C 8: 125,491,977 E207G probably damaging Het
Slc29a1 C A 17: 45,586,227 V378L probably damaging Het
Slc2a12 T G 10: 22,665,362 I372S possibly damaging Het
Slc7a10 T A 7: 35,195,214 Y99* probably null Het
Smco3 A G 6: 136,831,519 V119A probably damaging Het
Sptlc3 C T 2: 139,494,234 T10I probably benign Het
Sri T A 5: 8,063,323 W105R probably damaging Het
Stk35 T C 2: 129,810,571 Y331H probably damaging Het
Tipin T C 9: 64,288,148 I12T probably benign Het
Tlr5 A G 1: 182,975,128 T666A probably benign Het
Tmprss11g C A 5: 86,492,144 V222L probably benign Het
Tnfrsf11b T A 15: 54,252,160 Y347F possibly damaging Het
Traf6 A G 2: 101,697,167 T421A probably benign Het
Trrap T A 5: 144,771,239 D30E possibly damaging Het
Ube2k T A 5: 65,594,504 Y162N probably damaging Het
Uck2 A T 1: 167,237,602 V49E probably damaging Het
Vcam1 A T 3: 116,110,943 Y718* probably null Het
Zan T C 5: 137,474,007 N159S probably damaging Het
Zfp438 A G 18: 5,210,788 L750P probably damaging Het
Zfp54 A T 17: 21,433,775 Y177F probably benign Het
Other mutations in Cabyr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Cabyr APN 18 12744610 missense probably damaging 0.99
R0547:Cabyr UTSW 18 12751016 missense probably benign 0.07
R0571:Cabyr UTSW 18 12750852 missense probably damaging 1.00
R1556:Cabyr UTSW 18 12744780 missense probably damaging 1.00
R3084:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3085:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3086:Cabyr UTSW 18 12750966 missense probably damaging 1.00
R3824:Cabyr UTSW 18 12751690 missense probably benign 0.04
R3898:Cabyr UTSW 18 12751523 missense probably benign 0.00
R4869:Cabyr UTSW 18 12751818 makesense probably null
R4933:Cabyr UTSW 18 12744492 splice site probably benign
R5036:Cabyr UTSW 18 12751246 missense probably damaging 1.00
R5482:Cabyr UTSW 18 12751439 missense possibly damaging 0.95
R5932:Cabyr UTSW 18 12754350 missense probably damaging 1.00
R6515:Cabyr UTSW 18 12754283 missense possibly damaging 0.93
R6556:Cabyr UTSW 18 12751016 missense probably benign 0.07
R6852:Cabyr UTSW 18 12754097 missense probably benign 0.35
R6907:Cabyr UTSW 18 12750912 missense probably benign 0.05
R7193:Cabyr UTSW 18 12751758 missense probably damaging 1.00
R7565:Cabyr UTSW 18 12744599 missense possibly damaging 0.50
R7777:Cabyr UTSW 18 12744771 missense probably damaging 1.00
R7941:Cabyr UTSW 18 12744768 missense probably damaging 1.00
R8243:Cabyr UTSW 18 12750702 missense probably benign 0.00
R8406:Cabyr UTSW 18 12750747 missense probably benign 0.04
R8914:Cabyr UTSW 18 12751020 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCACAGTTTCTGCAGAACCC -3'
(R):5'- TTTCGCCAGCAATACCATAACTTC -3'

Sequencing Primer
(F):5'- CGAAAGTCACGTCTCCAACTTATGTG -3'
(R):5'- TACCATAACTTCCAAAGGGAGTACG -3'
Posted On 2022-02-07