Mutagenetix > Incidental Mutation

Incidental Mutation 'R9224:Prune2'

699740

Institutional Source

Beutler Lab

Gene Symbol

Prune2

Ensembl Gene

ENSMUSG00000039126

Gene Name

prune homolog 2

Synonyms

A230083H22Rik, 6330414G02Rik, A330102H22Rik

Accession Numbers

Genbank: NM_181348

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9224 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

16956118-17223932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 17120029 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 966 (T966A)

Ref Sequence

ENSEMBL: ENSMUSP00000084977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087689]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000087689
AA Change: T966A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: T966A

Domain	Start	End	E-Value	Type
DHHA2	208	351	8.32e-17	SMART
low complexity region	433	445	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	547	553	N/A	INTRINSIC
low complexity region	962	975	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1368	1378	N/A	INTRINSIC
low complexity region	1533	1545	N/A	INTRINSIC
low complexity region	1668	1685	N/A	INTRINSIC
low complexity region	1740	1751	N/A	INTRINSIC
low complexity region	2162	2175	N/A	INTRINSIC
low complexity region	2222	2233	N/A	INTRINSIC
low complexity region	2591	2606	N/A	INTRINSIC
low complexity region	2731	2744	N/A	INTRINSIC
SEC14	2882	3037	2.08e-12	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	C	T	19: 3,717,100	S229L	possibly damaging	Het
Actc1	TGA	T	2: 114,049,229		probably null	Het
Actl9	G	A	17: 33,434,030	A355T	probably benign	Het
Adamts8	A	G	9: 30,942,892	Q19R	probably benign	Het
Akr1c14	A	T	13: 4,080,695	Y216F	possibly damaging	Het
Alms1	T	C	6: 85,621,788	C1199R	possibly damaging	Het
Apc2	T	C	10: 80,314,277	S1722P	probably damaging	Het
Arid1a	T	C	4: 133,681,856	E1395G	unknown	Het
Atp6v0e2	T	C	6: 48,539,256	V46A	possibly damaging	Het
Bcar3	A	G	3: 122,525,442	R743G	probably damaging	Het
Bhmt2	A	G	13: 93,669,346	V56A	probably damaging	Het
Bsn	C	A	9: 108,105,487	R917L		Het
Cabyr	T	G	18: 12,754,221	V303G	possibly damaging	Het
Carmil1	A	T	13: 24,108,529	I429N	probably damaging	Het
Ccdc27	T	C	4: 154,037,717	N235D	unknown	Het
Ccdc61	T	C	7: 18,903,821	M37V	probably benign	Het
Cd40	A	T	2: 165,056,796	I48F	unknown	Het
Cdk13	A	T	13: 17,766,486	S664R	probably damaging	Het
Cel	TTA	TTATA	2: 28,559,429		probably null	Het
Cfap46	T	A	7: 139,678,500	R286*	probably null	Het
Ckap2	A	C	8: 22,169,938	I509S	possibly damaging	Het
Clptm1l	A	T	13: 73,604,225		probably benign	Het
Col11a1	T	G	3: 114,208,280	M1591R	unknown	Het
Col6a5	C	A	9: 105,937,395	A473S	unknown	Het
Cxcr2	T	A	1: 74,158,597	D83E	probably damaging	Het
Cyp2c39	G	A	19: 39,538,888	C226Y	probably benign	Het
Ddr1	A	C	17: 35,689,717	F352C	probably damaging	Het
Defb22	T	A	2: 152,485,801	T155S	unknown	Het
Dennd4c	G	T	4: 86,819,933	E935*	probably null	Het
Dst	A	C	1: 34,291,798	E4889D	probably damaging	Het
Emilin1	T	A	5: 30,917,479	C355S	probably damaging	Het
Enpp3	C	T	10: 24,774,818	V807I	probably benign	Het
Fcnb	T	A	2: 28,079,148	D179V	probably damaging	Het
Ficd	T	A	5: 113,737,135	D88E	probably benign	Het
Fndc3b	T	C	3: 27,470,301	K437E	possibly damaging	Het
Fyb2	T	A	4: 104,995,908	W566R	probably benign	Het
Gm11639	A	G	11: 104,770,975	Q1314R	probably benign	Het
Gm14403	A	G	2: 177,508,543	Q94R	probably benign	Het
Gm14548	T	C	7: 3,897,235	T123A	probably benign	Het
Gm32687	T	A	10: 81,879,032	I86N	probably benign	Het
Gpam	T	G	19: 55,087,475	D235A	probably damaging	Het
Gstt4	T	C	10: 75,815,212	E192G	probably damaging	Het
H2-Q6	T	G	17: 35,425,333	V97G	probably benign	Het
Hcn1	G	A	13: 117,925,718	G507S	unknown	Het
Hydin	T	C	8: 110,532,884	I2496T	probably benign	Het
Jund	A	G	8: 70,699,215	D53G	probably damaging	Het
Kat6b	T	A	14: 21,669,963	M1461K	probably benign	Het
Lnx1	T	G	5: 74,606,149	K435Q	probably benign	Het
Lpcat1	C	A	13: 73,510,042	L316M	probably damaging	Het
Lrrtm3	ATTTT	ATTTTT	10: 64,089,256		probably null	Het
Ly6c1	T	A	15: 75,044,616	T126S	probably benign	Het
Macf1	A	G	4: 123,432,897	S4938P	probably damaging	Het
Map2k2	T	C	10: 81,118,174	V158A	possibly damaging	Het
Map3k4	A	G	17: 12,238,086	V1323A	probably damaging	Het
Map4k5	A	T	12: 69,892,693	V23E	possibly damaging	Het
Med30	T	G	15: 52,719,443	L92R	probably damaging	Het
Mroh8	C	T	2: 157,221,149	G851S	possibly damaging	Het
Msmb	T	A	14: 32,158,103	C83*	probably null	Het
Mtif2	A	T	11: 29,544,364	R655S	probably benign	Het
Myo10	C	T	15: 25,807,995	S1901L	probably benign	Het
Myom2	A	T	8: 15,128,804	I1279F	possibly damaging	Het
Nat9	T	C	11: 115,184,615	I67V	probably damaging	Het
Ncam1	A	G	9: 49,508,695	S774P	probably damaging	Het
Ndufaf6	T	C	4: 11,062,089	T181A	probably damaging	Het
Nlrp4f	T	A	13: 65,185,015	K110*	probably null	Het
Nlrp9b	T	C	7: 20,019,292	S41P	probably benign	Het
Nlrp9b	A	G	7: 20,023,551	T238A	probably benign	Het
Noxo1	A	T	17: 24,700,331	E342D	probably benign	Het
Nt5dc2	T	C	14: 31,135,708	M55T	probably benign	Het
Olfr1040	T	A	2: 86,145,876	N286I	probably damaging	Het
Olfr342	A	T	2: 36,527,826	Q138L	probably benign	Het
Olfr453	T	C	6: 42,744,970	F311S	probably benign	Het
Olfr466	C	T	13: 65,152,389	T55I	probably damaging	Het
Olfr700	T	C	7: 106,806,282	Y60C	probably damaging	Het
Olfr782	T	A	10: 129,350,581	M6K	probably benign	Het
Olfr800	C	A	10: 129,660,138	L111M	probably damaging	Het
Olfr92	T	C	17: 37,111,875	T36A	possibly damaging	Het
P4ha2	C	T	11: 54,119,137	P240L	possibly damaging	Het
Pcdha11	T	A	18: 37,006,020	L234Q	probably damaging	Het
Pgm3	C	T	9: 86,556,362	A457T	probably benign	Het
Pkp4	T	C	2: 59,314,394	V533A	probably benign	Het
Plac8l1	T	C	18: 42,192,637	T68A	possibly damaging	Het
Pou2f3	A	T	9: 43,139,399	I222N	probably damaging	Het
Ppp1r14d	T	C	2: 119,229,741	D20G	probably benign	Het
Ppp1r37	C	A	7: 19,531,804	G679V	probably damaging	Het
Ppp6r2	T	A	15: 89,262,396	I199N	probably damaging	Het
Ptdss2	T	C	7: 141,154,885	V375A	probably benign	Het
Rara	TGCCCCGC	TGCCCCGCCCCGC	11: 98,966,410		probably null	Het
Rin2	T	A	2: 145,878,902	C718*	probably null	Het
Rptor	C	T	11: 119,894,287	T1170I	probably benign	Het
Samd5	T	C	10: 9,674,515	Y150C	probably damaging	Het
Setd1b	T	C	5: 123,158,710	S1245P	unknown	Het
Sipa1l2	T	C	8: 125,491,977	E207G	probably damaging	Het
Slc29a1	C	A	17: 45,586,227	V378L	probably damaging	Het
Slc2a12	T	G	10: 22,665,362	I372S	possibly damaging	Het
Slc7a10	T	A	7: 35,195,214	Y99*	probably null	Het
Smco3	A	G	6: 136,831,519	V119A	probably damaging	Het
Sptlc3	C	T	2: 139,494,234	T10I	probably benign	Het
Sri	T	A	5: 8,063,323	W105R	probably damaging	Het
Stk35	T	C	2: 129,810,571	Y331H	probably damaging	Het
Tipin	T	C	9: 64,288,148	I12T	probably benign	Het
Tlr5	A	G	1: 182,975,128	T666A	probably benign	Het
Tmprss11g	C	A	5: 86,492,144	V222L	probably benign	Het
Tnfrsf11b	T	A	15: 54,252,160	Y347F	possibly damaging	Het
Traf6	A	G	2: 101,697,167	T421A	probably benign	Het
Trrap	T	A	5: 144,771,239	D30E	possibly damaging	Het
Ube2k	T	A	5: 65,594,504	Y162N	probably damaging	Het
Uck2	A	T	1: 167,237,602	V49E	probably damaging	Het
Vcam1	A	T	3: 116,110,943	Y718*	probably null	Het
Zan	T	C	5: 137,474,007	N159S	probably damaging	Het
Zfp438	A	G	18: 5,210,788	L750P	probably damaging	Het
Zfp54	A	T	17: 21,433,775	Y177F	probably benign	Het

Other mutations in Prune2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Prune2	APN	19	17168344	critical splice donor site	probably null
IGL00848:Prune2	APN	19	17119118	missense	probably damaging	1.00
IGL00862:Prune2	APN	19	17119349	missense	probably benign	0.41
IGL00915:Prune2	APN	19	17016253	missense	probably damaging	1.00
IGL01084:Prune2	APN	19	17118209	missense	probably benign	0.19
IGL01109:Prune2	APN	19	17123879	missense	probably benign	0.03
IGL01372:Prune2	APN	19	17125069	missense	probably damaging	1.00
IGL01650:Prune2	APN	19	17168292	missense	possibly damaging	0.95
IGL01752:Prune2	APN	19	17123903	missense	possibly damaging	0.50
IGL01812:Prune2	APN	19	17003777	missense	possibly damaging	0.50
IGL01902:Prune2	APN	19	17118638	missense	probably benign	0.00
IGL02195:Prune2	APN	19	17119557	missense	probably benign	0.00
IGL02502:Prune2	APN	19	17123881	missense	probably benign	0.00
IGL02569:Prune2	APN	19	17178859	missense	probably damaging	0.99
IGL02693:Prune2	APN	19	17124491	missense	probably benign	0.03
IGL02737:Prune2	APN	19	17193411	nonsense	probably null
IGL02794:Prune2	APN	19	17119361	missense	probably benign	0.19
IGL02985:Prune2	APN	19	17016359	critical splice donor site	probably null
IGL03349:Prune2	APN	19	17123346	missense	probably damaging	1.00
3-1:Prune2	UTSW	19	17125282	missense	probably benign	0.00
R0060:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0165:Prune2	UTSW	19	17122610	missense	probably benign	0.00
R0277:Prune2	UTSW	19	17121389	missense	probably damaging	0.99
R0321:Prune2	UTSW	19	17120927	missense	possibly damaging	0.78
R0321:Prune2	UTSW	19	17122454	missense	probably benign	0.39
R0374:Prune2	UTSW	19	17120910	missense	probably benign	0.00
R0380:Prune2	UTSW	19	17124007	missense	probably damaging	1.00
R0396:Prune2	UTSW	19	17123080	missense	probably benign	0.35
R0408:Prune2	UTSW	19	17122310	missense	probably benign	0.00
R0421:Prune2	UTSW	19	17123311	missense	probably benign	0.02
R0480:Prune2	UTSW	19	17006792	splice site	probably benign
R0531:Prune2	UTSW	19	17006753	missense	probably damaging	1.00
R0546:Prune2	UTSW	19	17020666	splice site	probably benign
R0554:Prune2	UTSW	19	17125218	nonsense	probably null
R0659:Prune2	UTSW	19	17122835	missense	probably damaging	1.00
R0699:Prune2	UTSW	19	17123955	missense	probably damaging	1.00
R0781:Prune2	UTSW	19	17125222	missense	probably benign
R1110:Prune2	UTSW	19	17125222	missense	probably benign
R1178:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1181:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1337:Prune2	UTSW	19	17119607	missense	possibly damaging	0.70
R1356:Prune2	UTSW	19	17212317	missense	probably benign	0.40
R1385:Prune2	UTSW	19	17124948	missense	possibly damaging	0.50
R1659:Prune2	UTSW	19	17120651	missense	possibly damaging	0.59
R1738:Prune2	UTSW	19	17125010	missense	probably benign	0.01
R1756:Prune2	UTSW	19	17123704	missense	probably benign	0.01
R1765:Prune2	UTSW	19	17125598	missense	probably damaging	1.00
R1782:Prune2	UTSW	19	17122173	missense	probably benign	0.00
R1817:Prune2	UTSW	19	17122081	missense	probably benign	0.00
R1838:Prune2	UTSW	19	17199878	missense	probably damaging	1.00
R1851:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1852:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1866:Prune2	UTSW	19	17123492	missense	probably damaging	1.00
R1911:Prune2	UTSW	19	17113674	missense	probably benign	0.02
R1983:Prune2	UTSW	19	17020642	missense	probably damaging	0.97
R2014:Prune2	UTSW	19	17120523	missense	probably damaging	1.00
R2066:Prune2	UTSW	19	17120678	missense	possibly damaging	0.57
R2088:Prune2	UTSW	19	17119745	missense	possibly damaging	0.95
R2111:Prune2	UTSW	19	17208238	missense	probably damaging	1.00
R2128:Prune2	UTSW	19	17122422	missense	probably benign	0.00
R2165:Prune2	UTSW	19	17120182	missense	probably benign	0.19
R2241:Prune2	UTSW	19	17123092	missense	probably damaging	0.96
R2278:Prune2	UTSW	19	17118555	missense	possibly damaging	0.93
R2504:Prune2	UTSW	19	17000036	missense	probably damaging	1.00
R2508:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R3055:Prune2	UTSW	19	17125043	missense	probably damaging	0.98
R3086:Prune2	UTSW	19	17121413	missense	possibly damaging	0.75
R3104:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3105:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3547:Prune2	UTSW	19	17124348	missense	probably damaging	0.96
R3702:Prune2	UTSW	19	17178871	missense	probably damaging	1.00
R3753:Prune2	UTSW	19	17125454	missense	probably benign	0.38
R3933:Prune2	UTSW	19	17123954	missense	probably damaging	1.00
R3935:Prune2	UTSW	19	17199786	missense	probably damaging	1.00
R4022:Prune2	UTSW	19	17000020	missense	probably damaging	1.00
R4042:Prune2	UTSW	19	17003826	critical splice donor site	probably null
R4164:Prune2	UTSW	19	17003734	missense	possibly damaging	0.87
R4453:Prune2	UTSW	19	17121910	missense	probably benign	0.00
R4642:Prune2	UTSW	19	17020655	critical splice donor site	probably null
R4661:Prune2	UTSW	19	17000023	missense	probably damaging	1.00
R4666:Prune2	UTSW	19	17120188	nonsense	probably null
R4823:Prune2	UTSW	19	17120504	missense	probably damaging	1.00
R4897:Prune2	UTSW	19	17121855	missense	probably benign	0.03
R4922:Prune2	UTSW	19	17122752	missense	probably benign	0.00
R4962:Prune2	UTSW	19	17122273	missense	probably benign	0.11
R5026:Prune2	UTSW	19	17199142	missense	probably damaging	1.00
R5042:Prune2	UTSW	19	17119797	missense	possibly damaging	0.94
R5124:Prune2	UTSW	19	17199910	missense	probably damaging	1.00
R5133:Prune2	UTSW	19	17003631	missense	probably damaging	1.00
R5184:Prune2	UTSW	19	17216357	missense	possibly damaging	0.95
R5234:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5339:Prune2	UTSW	19	17120872	missense	probably damaging	1.00
R5363:Prune2	UTSW	19	17118266	missense	probably damaging	1.00
R5382:Prune2	UTSW	19	17003659	missense	probably damaging	1.00
R5436:Prune2	UTSW	19	17020643	missense	probably damaging	1.00
R5480:Prune2	UTSW	19	17120947	missense	possibly damaging	0.66
R5635:Prune2	UTSW	19	17118209	missense	probably benign	0.19
R5678:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5814:Prune2	UTSW	19	17016361	splice site	probably null
R5894:Prune2	UTSW	19	17121391	missense	possibly damaging	0.88
R6011:Prune2	UTSW	19	17118716	missense	probably benign	0.35
R6207:Prune2	UTSW	19	17118116	missense	probably damaging	1.00
R6218:Prune2	UTSW	19	17121562	missense	probably benign	0.00
R6573:Prune2	UTSW	19	17121157	missense	probably damaging	1.00
R6573:Prune2	UTSW	19	17121158	missense	possibly damaging	0.61
R6734:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R6805:Prune2	UTSW	19	17120590	missense	probably benign
R6837:Prune2	UTSW	19	17178928	missense	probably damaging	1.00
R6850:Prune2	UTSW	19	17122188	missense	probably benign	0.00
R6858:Prune2	UTSW	19	17118106	missense	possibly damaging	0.70
R6874:Prune2	UTSW	19	17123228	missense	probably damaging	1.00
R6954:Prune2	UTSW	19	17000021	missense	probably damaging	1.00
R7098:Prune2	UTSW	19	17120602	missense	probably benign	0.39
R7102:Prune2	UTSW	19	17121213	missense	probably benign	0.24
R7246:Prune2	UTSW	19	17121368	missense	probably damaging	0.99
R7284:Prune2	UTSW	19	17119886	missense	probably damaging	1.00
R7295:Prune2	UTSW	19	17119897	missense	probably benign	0.01
R7371:Prune2	UTSW	19	17119370	missense	probably benign	0.02
R7651:Prune2	UTSW	19	17120408	missense	probably damaging	1.00
R7830:Prune2	UTSW	19	17122674	missense	probably benign	0.21
R7872:Prune2	UTSW	19	17119434	missense	probably benign	0.05
R7881:Prune2	UTSW	19	17123029	missense	possibly damaging	0.50
R7966:Prune2	UTSW	19	17178859	missense	probably damaging	0.99
R7969:Prune2	UTSW	19	17201670	missense	probably damaging	0.98
R8092:Prune2	UTSW	19	17119993	missense	probably damaging	1.00
R8110:Prune2	UTSW	19	17120719	missense	probably benign	0.22
R8115:Prune2	UTSW	19	17123924	missense	probably benign	0.02
R8129:Prune2	UTSW	19	17118836	missense	probably benign	0.01
R8169:Prune2	UTSW	19	17125091	missense	probably benign	0.10
R8171:Prune2	UTSW	19	17120518	missense	probably damaging	1.00
R8176:Prune2	UTSW	19	17118292	missense	probably damaging	1.00
R8200:Prune2	UTSW	19	17124973	missense	probably benign	0.01
R8217:Prune2	UTSW	19	17120116	missense	probably benign	0.01
R8258:Prune2	UTSW	19	17212308	missense	unknown
R8259:Prune2	UTSW	19	17212308	missense	unknown
R8289:Prune2	UTSW	19	17123009	missense	probably benign	0.43
R8329:Prune2	UTSW	19	17121265	missense	probably benign	0.02
R8342:Prune2	UTSW	19	17125663	missense	probably benign	0.01
R8558:Prune2	UTSW	19	17122238	missense	probably damaging	0.98
R8732:Prune2	UTSW	19	17120405	missense	probably damaging	1.00
R8743:Prune2	UTSW	19	17119556	missense	probably benign	0.22
R8769:Prune2	UTSW	19	17123078	missense	probably damaging	0.96
R8862:Prune2	UTSW	19	17120146	missense	probably benign	0.04
R8936:Prune2	UTSW	19	17121835	missense	probably benign	0.24
R9040:Prune2	UTSW	19	17120627	missense	probably damaging	1.00
R9084:Prune2	UTSW	19	17120377	missense	probably damaging	1.00
R9273:Prune2	UTSW	19	17118326	missense	possibly damaging	0.74
R9275:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9278:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9290:Prune2	UTSW	19	17168327	missense	probably benign	0.41
R9305:Prune2	UTSW	19	17120261	missense	probably benign	0.14
R9317:Prune2	UTSW	19	17121670	missense	probably benign	0.00
R9354:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R9373:Prune2	UTSW	19	17122138	missense	probably benign
R9394:Prune2	UTSW	19	17003689	missense	probably damaging	1.00
R9405:Prune2	UTSW	19	17216344	missense	probably damaging	0.99
R9476:Prune2	UTSW	19	17119342	missense	possibly damaging	0.64
R9532:Prune2	UTSW	19	17122430	missense	probably benign	0.00
X0019:Prune2	UTSW	19	17121517	missense	probably benign	0.16
X0028:Prune2	UTSW	19	17122885	missense	probably damaging	1.00
X0064:Prune2	UTSW	19	17122375	missense	probably damaging	1.00
X0066:Prune2	UTSW	19	17118790	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTTGGTGGATCCTAAAGC -3'
(R):5'- ATGCCCACATGTCTAGATTCCC -3'

Sequencing Primer
(F):5'- CTTGGTGGATCCTAAAGCTACAG -3'
(R):5'- TGTCTAGATTCCCAGGACCAG -3'

Posted On

2022-02-07