Incidental Mutation 'R9225:Spen'
ID 699765
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Name spen family transcription repressor
Synonyms Mint
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9225 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 141467890-141538597 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 141475632 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1895 (T1895A)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000078886
AA Change: T1872A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: T1872A

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105786
AA Change: T1895A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: T1895A

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 87,972,574 V397L probably benign Het
Adam26b G T 8: 43,520,416 Y516* probably null Het
Afap1 A G 5: 35,976,624 K468E possibly damaging Het
Ank2 A G 3: 126,942,462 S3258P unknown Het
Ap1g1 A G 8: 109,858,877 K783E probably benign Het
Apbb1 A G 7: 105,568,856 S20P Het
Atg13 T C 2: 91,688,783 probably null Het
Atg16l2 A G 7: 101,301,981 V16A probably benign Het
Atp11a G A 8: 12,817,005 R144Q probably benign Het
Avpr1a A T 10: 122,449,561 T253S probably benign Het
B4galnt3 T C 6: 120,218,967 T300A probably damaging Het
Bag4 A G 8: 25,771,242 V157A probably benign Het
Brsk2 A G 7: 141,993,302 H494R probably damaging Het
Cacna2d2 G A 9: 107,526,204 G955S probably benign Het
Ccdc42 A T 11: 68,588,235 E83V probably damaging Het
Cep120 T C 18: 53,706,824 Q788R probably benign Het
Cnbd1 A G 4: 18,907,010 I188T probably benign Het
Col6a6 C T 9: 105,782,238 E503K possibly damaging Het
Cpt1c A T 7: 44,960,789 L661H probably damaging Het
Cyp2a22 T C 7: 26,937,777 D194G possibly damaging Het
Cyp2c70 C A 19: 40,180,468 R125L probably damaging Het
Cyp3a41a A T 5: 145,713,604 D76E probably benign Het
Cyp4f13 A T 17: 32,925,345 I458N probably damaging Het
Cyp4f13 T C 17: 32,929,201 Q350R probably damaging Het
Ddx60 G A 8: 62,017,841 V1456I probably benign Het
Dgkh T C 14: 78,725,067 H8R probably damaging Het
Diaph3 A G 14: 87,007,324 probably null Het
Dnah8 A C 17: 30,635,673 D103A probably benign Het
Dock4 G A 12: 40,829,670 R1551Q probably benign Het
Eps8 A T 6: 137,530,563 S56T probably benign Het
Fam171b T A 2: 83,880,042 L686Q probably damaging Het
Fndc3b A C 3: 27,456,531 L814* probably null Het
Gcnt2 T A 13: 40,860,860 L169Q probably damaging Het
Gm21103 T A 14: 6,303,883 I56F possibly damaging Het
Gpc1 A T 1: 92,856,020 K276N probably damaging Het
Hivep1 T A 13: 42,183,708 V2421D probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ifi208 A G 1: 173,690,728 D467G possibly damaging Het
Klhl22 A G 16: 17,776,753 M249V probably damaging Het
Kmt2b A G 7: 30,586,747 V240A unknown Het
Lacc1 A T 14: 77,034,974 Y127* probably null Het
Lgr4 C A 2: 110,012,140 H823Q probably benign Het
Llgl1 T C 11: 60,710,063 S662P probably damaging Het
Lrrc1 G A 9: 77,452,673 T279I probably benign Het
Lrrc8e T A 8: 4,234,561 V262E probably damaging Het
Magi1 G T 6: 93,785,530 P292T possibly damaging Het
Mccc1 T A 3: 35,964,362 I608F probably benign Het
Mroh8 T A 2: 157,265,090 I220L probably damaging Het
Mycn C A 12: 12,937,608 D263Y probably damaging Het
Myrip A G 9: 120,464,784 K782E probably damaging Het
Ncoa6 T A 2: 155,407,521 I1288F possibly damaging Het
Nebl A G 2: 17,400,511 I399T possibly damaging Het
Neurod1 A T 2: 79,454,387 H217Q probably benign Het
Nlrp5 T C 7: 23,417,946 V365A probably benign Het
Olfr1452-ps1 A G 19: 13,017,006 *261W probably null Het
Olfr1452-ps1 G C 19: 13,017,007 *261Y probably null Het
Olfr20 C A 11: 73,353,769 N5K probably damaging Het
Olfr693 A G 7: 106,677,769 V239A probably benign Het
Otud7a A G 7: 63,757,721 T591A possibly damaging Het
Pbx3 T C 2: 34,370,926 probably benign Het
Pcdhb4 A T 18: 37,308,642 Q335L possibly damaging Het
Plxnc1 C A 10: 94,793,199 C1571F probably damaging Het
Pola2 G A 19: 5,950,464 P330S probably benign Het
Ppm1l A T 3: 69,552,911 N274Y probably benign Het
Ppp4r3b A G 11: 29,205,648 D538G possibly damaging Het
Ptx4 C T 17: 25,122,722 T57I probably benign Het
Rchy1 A T 5: 91,957,537 C108* probably null Het
Rif1 A G 2: 52,111,850 E130G probably benign Het
Rmdn1 A T 4: 19,601,385 Y219F probably damaging Het
Rnf144a A G 12: 26,327,607 C46R probably damaging Het
Rpl13a C A 7: 45,126,203 G146V probably damaging Het
Rpl13a C A 7: 45,126,204 G146W probably damaging Het
Rtn3 A T 19: 7,457,489 N379K probably damaging Het
Sdc1 G T 12: 8,771,817 R19L unknown Het
Shank1 A G 7: 44,334,046 I651V unknown Het
Slamf6 T C 1: 171,936,703 V221A probably benign Het
Soga3 A T 10: 29,196,331 K540* probably null Het
Sp9 C A 2: 73,273,495 S131* probably null Het
Taf6l CGCAGCCGCACCTG CG 19: 8,774,324 probably benign Het
Thada G T 17: 84,441,744 H600N possibly damaging Het
Trmt11 G T 10: 30,547,757 P384Q probably damaging Het
Tsnaxip1 T C 8: 105,840,027 L165P probably damaging Het
Ttc7 A G 17: 87,330,074 Y419C probably damaging Het
Ugt1a6a T C 1: 88,138,838 F122S probably benign Het
Vmn1r218 G A 13: 23,136,654 C57Y probably benign Het
Vmn2r14 T C 5: 109,221,422 N95S probably damaging Het
Vmn2r2 G T 3: 64,126,600 H500Q probably benign Het
Vmn2r70 T A 7: 85,559,034 Y745F probably damaging Het
Zfp189 C T 4: 49,530,193 S432F probably benign Het
Zscan2 C T 7: 80,863,273 A2V probably damaging Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
filtered UTSW 4 141477372 missense unknown
mentholated UTSW 4 141469400 missense possibly damaging 0.78
R0105:Spen UTSW 4 141469810 splice site probably benign
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1899:Spen UTSW 4 141470343 missense probably benign 0.17
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2011:Spen UTSW 4 141473329 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R4771:Spen UTSW 4 141472596 missense probably benign 0.14
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5290:Spen UTSW 4 141473816 missense probably damaging 1.00
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5347:Spen UTSW 4 141471485 missense probably benign 0.26
R5511:Spen UTSW 4 141475064 missense possibly damaging 0.86
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
R6994:Spen UTSW 4 141493459 missense unknown
R7018:Spen UTSW 4 141493444 missense unknown
R7040:Spen UTSW 4 141494382 missense unknown
R7127:Spen UTSW 4 141476108 missense possibly damaging 0.53
R7218:Spen UTSW 4 141472650 missense possibly damaging 0.54
R7234:Spen UTSW 4 141479135 missense unknown
R7316:Spen UTSW 4 141477054 missense unknown
R7350:Spen UTSW 4 141479385 missense unknown
R7356:Spen UTSW 4 141471924 nonsense probably null
R7400:Spen UTSW 4 141473741 missense probably damaging 1.00
R7470:Spen UTSW 4 141479294 missense unknown
R7698:Spen UTSW 4 141472845 missense probably damaging 1.00
R7858:Spen UTSW 4 141488131 splice site probably null
R8033:Spen UTSW 4 141471746 missense probably benign 0.03
R8064:Spen UTSW 4 141475700 missense possibly damaging 0.53
R8159:Spen UTSW 4 141475003 missense possibly damaging 0.53
R8187:Spen UTSW 4 141472905 missense possibly damaging 0.93
R8463:Spen UTSW 4 141522279 missense unknown
R8557:Spen UTSW 4 141470370 missense probably benign 0.14
R8558:Spen UTSW 4 141470370 missense probably benign 0.14
R8672:Spen UTSW 4 141470370 missense probably benign 0.14
R8673:Spen UTSW 4 141470370 missense probably benign 0.14
R8674:Spen UTSW 4 141470370 missense probably benign 0.14
R8714:Spen UTSW 4 141488003 missense unknown
R8735:Spen UTSW 4 141469818 missense probably benign 0.32
R8762:Spen UTSW 4 141472950 missense probably damaging 1.00
R8877:Spen UTSW 4 141471826 nonsense probably null
R8878:Spen UTSW 4 141477209 missense unknown
R8937:Spen UTSW 4 141474063 missense probably damaging 1.00
R8939:Spen UTSW 4 141475658 missense possibly damaging 0.72
R8968:Spen UTSW 4 141470390 missense probably benign 0.02
R8971:Spen UTSW 4 141474578 missense possibly damaging 0.53
R9016:Spen UTSW 4 141473627 missense probably damaging 1.00
R9072:Spen UTSW 4 141476391 missense unknown
R9073:Spen UTSW 4 141476391 missense unknown
R9120:Spen UTSW 4 141472922 missense
R9136:Spen UTSW 4 141522312 missense unknown
R9138:Spen UTSW 4 141469486 missense probably damaging 1.00
R9150:Spen UTSW 4 141517157 missense unknown
R9492:Spen UTSW 4 141471787 missense probably benign 0.26
R9537:Spen UTSW 4 141471704 missense probably benign 0.15
R9537:Spen UTSW 4 141516845 small deletion probably benign
R9602:Spen UTSW 4 141477872 missense unknown
R9609:Spen UTSW 4 141488108 missense unknown
R9686:Spen UTSW 4 141472635 missense probably benign 0.27
R9697:Spen UTSW 4 141468964 missense probably damaging 1.00
R9713:Spen UTSW 4 141517020 missense unknown
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTTCTGAGACCTCGGTGAC -3'
(R):5'- ACAAGAGCAAGCGTTCCAAG -3'

Sequencing Primer
(F):5'- CTGGGTGTCTCTGCAGGCTC -3'
(R):5'- GAGCAAGCGTTCCAAGACGTC -3'
Posted On 2022-02-07