Incidental Mutation 'R9225:Myrip'
ID 699798
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Name myosin VIIA and Rab interacting protein
Synonyms A230081N12Rik, Slac2-c
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9225 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 120132996-120305167 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120293850 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 782 (K782E)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
AlphaFold Q8K3I4
Predicted Effect probably damaging
Transcript: ENSMUST00000048121
AA Change: K782E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: K782E

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 88,120,433 (GRCm39) V397L probably benign Het
Adam26b G T 8: 43,973,453 (GRCm39) Y516* probably null Het
Afap1 A G 5: 36,133,968 (GRCm39) K468E possibly damaging Het
Ank2 A G 3: 126,736,111 (GRCm39) S3258P unknown Het
Ap1g1 A G 8: 110,585,509 (GRCm39) K783E probably benign Het
Apbb1 A G 7: 105,218,063 (GRCm39) S20P Het
Atg13 T C 2: 91,519,128 (GRCm39) probably null Het
Atg16l2 A G 7: 100,951,188 (GRCm39) V16A probably benign Het
Atp11a G A 8: 12,867,005 (GRCm39) R144Q probably benign Het
Avpr1a A T 10: 122,285,466 (GRCm39) T253S probably benign Het
B4galnt3 T C 6: 120,195,928 (GRCm39) T300A probably damaging Het
Bag4 A G 8: 26,261,270 (GRCm39) V157A probably benign Het
Brsk2 A G 7: 141,547,039 (GRCm39) H494R probably damaging Het
Cacna2d2 G A 9: 107,403,403 (GRCm39) G955S probably benign Het
Ccdc42 A T 11: 68,479,061 (GRCm39) E83V probably damaging Het
Cep120 T C 18: 53,839,896 (GRCm39) Q788R probably benign Het
Cnbd1 A G 4: 18,907,010 (GRCm39) I188T probably benign Het
Col6a6 C T 9: 105,659,437 (GRCm39) E503K possibly damaging Het
Cpt1c A T 7: 44,610,213 (GRCm39) L661H probably damaging Het
Cyp2a22 T C 7: 26,637,202 (GRCm39) D194G possibly damaging Het
Cyp2c70 C A 19: 40,168,912 (GRCm39) R125L probably damaging Het
Cyp3a41a A T 5: 145,650,414 (GRCm39) D76E probably benign Het
Cyp4f13 A T 17: 33,144,319 (GRCm39) I458N probably damaging Het
Cyp4f13 T C 17: 33,148,175 (GRCm39) Q350R probably damaging Het
Ddx60 G A 8: 62,470,875 (GRCm39) V1456I probably benign Het
Dgkh T C 14: 78,962,507 (GRCm39) H8R probably damaging Het
Diaph3 A G 14: 87,244,760 (GRCm39) probably null Het
Dnah8 A C 17: 30,854,647 (GRCm39) D103A probably benign Het
Dock4 G A 12: 40,879,669 (GRCm39) R1551Q probably benign Het
Eps8 A T 6: 137,507,561 (GRCm39) S56T probably benign Het
Fam171b T A 2: 83,710,386 (GRCm39) L686Q probably damaging Het
Fndc3b A C 3: 27,510,680 (GRCm39) L814* probably null Het
Gcnt2 T A 13: 41,014,336 (GRCm39) L169Q probably damaging Het
Gm21103 T A 14: 17,484,877 (GRCm39) I56F possibly damaging Het
Gpc1 A T 1: 92,783,742 (GRCm39) K276N probably damaging Het
Hivep1 T A 13: 42,337,184 (GRCm39) V2421D probably damaging Het
Hoxb1 T C 11: 96,257,119 (GRCm39) L156P probably benign Het
Ifi208 A G 1: 173,518,294 (GRCm39) D467G possibly damaging Het
Klhl22 A G 16: 17,594,617 (GRCm39) M249V probably damaging Het
Kmt2b A G 7: 30,286,172 (GRCm39) V240A unknown Het
Lacc1 A T 14: 77,272,414 (GRCm39) Y127* probably null Het
Lgr4 C A 2: 109,842,485 (GRCm39) H823Q probably benign Het
Llgl1 T C 11: 60,600,889 (GRCm39) S662P probably damaging Het
Lrrc1 G A 9: 77,359,955 (GRCm39) T279I probably benign Het
Lrrc8e T A 8: 4,284,561 (GRCm39) V262E probably damaging Het
Magi1 G T 6: 93,762,511 (GRCm39) P292T possibly damaging Het
Mccc1 T A 3: 36,018,511 (GRCm39) I608F probably benign Het
Mroh8 T A 2: 157,107,010 (GRCm39) I220L probably damaging Het
Mtcl3 A T 10: 29,072,327 (GRCm39) K540* probably null Het
Mycn C A 12: 12,987,609 (GRCm39) D263Y probably damaging Het
Ncoa6 T A 2: 155,249,441 (GRCm39) I1288F possibly damaging Het
Nebl A G 2: 17,405,322 (GRCm39) I399T possibly damaging Het
Neurod1 A T 2: 79,284,731 (GRCm39) H217Q probably benign Het
Nlrp5 T C 7: 23,117,371 (GRCm39) V365A probably benign Het
Or1e1 C A 11: 73,244,595 (GRCm39) N5K probably damaging Het
Or2ag12 A G 7: 106,276,976 (GRCm39) V239A probably benign Het
Or5b100-ps1 G C 19: 12,994,371 (GRCm39) *261Y probably null Het
Or5b100-ps1 A G 19: 12,994,370 (GRCm39) *261W probably null Het
Otud7a A G 7: 63,407,469 (GRCm39) T591A possibly damaging Het
Pbx3 T C 2: 34,260,938 (GRCm39) probably benign Het
Pcdhb4 A T 18: 37,441,695 (GRCm39) Q335L possibly damaging Het
Plxnc1 C A 10: 94,629,061 (GRCm39) C1571F probably damaging Het
Pola2 G A 19: 6,000,492 (GRCm39) P330S probably benign Het
Ppm1l A T 3: 69,460,244 (GRCm39) N274Y probably benign Het
Ppp4r3b A G 11: 29,155,648 (GRCm39) D538G possibly damaging Het
Ptx4 C T 17: 25,341,696 (GRCm39) T57I probably benign Het
Rchy1 A T 5: 92,105,396 (GRCm39) C108* probably null Het
Rif1 A G 2: 52,001,862 (GRCm39) E130G probably benign Het
Rmdn1 A T 4: 19,601,385 (GRCm39) Y219F probably damaging Het
Rnf144a A G 12: 26,377,606 (GRCm39) C46R probably damaging Het
Rpl13a C A 7: 44,775,627 (GRCm39) G146V probably damaging Het
Rpl13a C A 7: 44,775,628 (GRCm39) G146W probably damaging Het
Rtn3 A T 19: 7,434,854 (GRCm39) N379K probably damaging Het
Sdc1 G T 12: 8,821,817 (GRCm39) R19L unknown Het
Shank1 A G 7: 43,983,470 (GRCm39) I651V unknown Het
Slamf6 T C 1: 171,764,270 (GRCm39) V221A probably benign Het
Sp9 C A 2: 73,103,839 (GRCm39) S131* probably null Het
Spen T C 4: 141,202,943 (GRCm39) T1895A possibly damaging Het
Taf6l CGCAGCCGCACCTG CG 19: 8,751,688 (GRCm39) probably benign Het
Thada G T 17: 84,749,172 (GRCm39) H600N possibly damaging Het
Trmt11 G T 10: 30,423,753 (GRCm39) P384Q probably damaging Het
Tsnaxip1 T C 8: 106,566,659 (GRCm39) L165P probably damaging Het
Ttc7 A G 17: 87,637,502 (GRCm39) Y419C probably damaging Het
Ugt1a6a T C 1: 88,066,560 (GRCm39) F122S probably benign Het
Vmn1r218 G A 13: 23,320,824 (GRCm39) C57Y probably benign Het
Vmn2r14 T C 5: 109,369,288 (GRCm39) N95S probably damaging Het
Vmn2r2 G T 3: 64,034,021 (GRCm39) H500Q probably benign Het
Vmn2r70 T A 7: 85,208,242 (GRCm39) Y745F probably damaging Het
Zfp189 C T 4: 49,530,193 (GRCm39) S432F probably benign Het
Zscan2 C T 7: 80,513,021 (GRCm39) A2V probably damaging Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120,217,330 (GRCm39) missense probably damaging 1.00
IGL02108:Myrip APN 9 120,296,631 (GRCm39) critical splice donor site probably null
IGL02406:Myrip APN 9 120,296,598 (GRCm39) missense probably benign
IGL02876:Myrip APN 9 120,261,740 (GRCm39) missense probably damaging 1.00
IGL03109:Myrip APN 9 120,282,790 (GRCm39) splice site probably null
IGL03258:Myrip APN 9 120,270,418 (GRCm39) missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120,296,583 (GRCm39) missense probably damaging 0.98
R0485:Myrip UTSW 9 120,270,443 (GRCm39) missense probably benign 0.01
R0633:Myrip UTSW 9 120,217,302 (GRCm39) missense probably damaging 1.00
R1489:Myrip UTSW 9 120,261,595 (GRCm39) missense probably damaging 1.00
R1539:Myrip UTSW 9 120,253,689 (GRCm39) missense probably benign 0.00
R1708:Myrip UTSW 9 120,293,840 (GRCm39) missense possibly damaging 0.65
R1817:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1818:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1878:Myrip UTSW 9 120,253,721 (GRCm39) missense probably damaging 0.99
R2484:Myrip UTSW 9 120,253,685 (GRCm39) missense probably benign 0.00
R3237:Myrip UTSW 9 120,270,473 (GRCm39) missense possibly damaging 0.91
R3890:Myrip UTSW 9 120,251,324 (GRCm39) missense probably damaging 1.00
R3912:Myrip UTSW 9 120,261,682 (GRCm39) missense probably benign
R3919:Myrip UTSW 9 120,261,695 (GRCm39) missense probably damaging 1.00
R4125:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4126:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4128:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4435:Myrip UTSW 9 120,164,680 (GRCm39) start gained probably benign
R4599:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
R5014:Myrip UTSW 9 120,251,534 (GRCm39) missense probably damaging 1.00
R5665:Myrip UTSW 9 120,290,499 (GRCm39) missense probably damaging 1.00
R5814:Myrip UTSW 9 120,253,734 (GRCm39) missense probably benign 0.06
R5849:Myrip UTSW 9 120,282,759 (GRCm39) missense probably damaging 0.99
R5986:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R6706:Myrip UTSW 9 120,217,359 (GRCm39) missense possibly damaging 0.93
R7019:Myrip UTSW 9 120,251,573 (GRCm39) missense probably damaging 1.00
R7291:Myrip UTSW 9 120,246,207 (GRCm39) missense probably damaging 0.97
R8204:Myrip UTSW 9 120,262,045 (GRCm39) critical splice donor site probably null
R8557:Myrip UTSW 9 120,246,252 (GRCm39) missense probably benign 0.32
R8853:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R8911:Myrip UTSW 9 120,270,484 (GRCm39) missense possibly damaging 0.94
R9106:Myrip UTSW 9 120,261,544 (GRCm39) missense probably benign 0.37
Z1177:Myrip UTSW 9 120,270,547 (GRCm39) missense probably damaging 1.00
Z1177:Myrip UTSW 9 120,261,844 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCATTGTAGCGGTGGATAGAC -3'
(R):5'- AAGTGCAACATACCTTTCACAG -3'

Sequencing Primer
(F):5'- GTGTTGAAGTGCACACCTGTAATCC -3'
(R):5'- CTTTCACAGGAGGGGCAG -3'
Posted On 2022-02-07