Incidental Mutation 'R9225:Myrip'
ID 699798
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Name myosin VIIA and Rab interacting protein
Synonyms A230081N12Rik, Slac2-c
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9225 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 120301513-120474841 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120464784 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 782 (K782E)
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
AlphaFold Q8K3I4
Predicted Effect probably damaging
Transcript: ENSMUST00000048121
AA Change: K782E

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: K782E

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik G T 5: 87,972,574 V397L probably benign Het
Adam26b G T 8: 43,520,416 Y516* probably null Het
Afap1 A G 5: 35,976,624 K468E possibly damaging Het
Ank2 A G 3: 126,942,462 S3258P unknown Het
Ap1g1 A G 8: 109,858,877 K783E probably benign Het
Apbb1 A G 7: 105,568,856 S20P Het
Atg13 T C 2: 91,688,783 probably null Het
Atg16l2 A G 7: 101,301,981 V16A probably benign Het
Atp11a G A 8: 12,817,005 R144Q probably benign Het
Avpr1a A T 10: 122,449,561 T253S probably benign Het
B4galnt3 T C 6: 120,218,967 T300A probably damaging Het
Bag4 A G 8: 25,771,242 V157A probably benign Het
Brsk2 A G 7: 141,993,302 H494R probably damaging Het
Cacna2d2 G A 9: 107,526,204 G955S probably benign Het
Ccdc42 A T 11: 68,588,235 E83V probably damaging Het
Cep120 T C 18: 53,706,824 Q788R probably benign Het
Cnbd1 A G 4: 18,907,010 I188T probably benign Het
Col6a6 C T 9: 105,782,238 E503K possibly damaging Het
Cpt1c A T 7: 44,960,789 L661H probably damaging Het
Cyp2a22 T C 7: 26,937,777 D194G possibly damaging Het
Cyp2c70 C A 19: 40,180,468 R125L probably damaging Het
Cyp3a41a A T 5: 145,713,604 D76E probably benign Het
Cyp4f13 A T 17: 32,925,345 I458N probably damaging Het
Cyp4f13 T C 17: 32,929,201 Q350R probably damaging Het
Ddx60 G A 8: 62,017,841 V1456I probably benign Het
Dgkh T C 14: 78,725,067 H8R probably damaging Het
Diaph3 A G 14: 87,007,324 probably null Het
Dnah8 A C 17: 30,635,673 D103A probably benign Het
Dock4 G A 12: 40,829,670 R1551Q probably benign Het
Eps8 A T 6: 137,530,563 S56T probably benign Het
Fam171b T A 2: 83,880,042 L686Q probably damaging Het
Fndc3b A C 3: 27,456,531 L814* probably null Het
Gcnt2 T A 13: 40,860,860 L169Q probably damaging Het
Gm21103 T A 14: 6,303,883 I56F possibly damaging Het
Gpc1 A T 1: 92,856,020 K276N probably damaging Het
Hivep1 T A 13: 42,183,708 V2421D probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ifi208 A G 1: 173,690,728 D467G possibly damaging Het
Klhl22 A G 16: 17,776,753 M249V probably damaging Het
Kmt2b A G 7: 30,586,747 V240A unknown Het
Lacc1 A T 14: 77,034,974 Y127* probably null Het
Lgr4 C A 2: 110,012,140 H823Q probably benign Het
Llgl1 T C 11: 60,710,063 S662P probably damaging Het
Lrrc1 G A 9: 77,452,673 T279I probably benign Het
Lrrc8e T A 8: 4,234,561 V262E probably damaging Het
Magi1 G T 6: 93,785,530 P292T possibly damaging Het
Mccc1 T A 3: 35,964,362 I608F probably benign Het
Mroh8 T A 2: 157,265,090 I220L probably damaging Het
Mycn C A 12: 12,937,608 D263Y probably damaging Het
Ncoa6 T A 2: 155,407,521 I1288F possibly damaging Het
Nebl A G 2: 17,400,511 I399T possibly damaging Het
Neurod1 A T 2: 79,454,387 H217Q probably benign Het
Nlrp5 T C 7: 23,417,946 V365A probably benign Het
Olfr1452-ps1 A G 19: 13,017,006 *261W probably null Het
Olfr1452-ps1 G C 19: 13,017,007 *261Y probably null Het
Olfr20 C A 11: 73,353,769 N5K probably damaging Het
Olfr693 A G 7: 106,677,769 V239A probably benign Het
Otud7a A G 7: 63,757,721 T591A possibly damaging Het
Pbx3 T C 2: 34,370,926 probably benign Het
Pcdhb4 A T 18: 37,308,642 Q335L possibly damaging Het
Plxnc1 C A 10: 94,793,199 C1571F probably damaging Het
Pola2 G A 19: 5,950,464 P330S probably benign Het
Ppm1l A T 3: 69,552,911 N274Y probably benign Het
Ppp4r3b A G 11: 29,205,648 D538G possibly damaging Het
Ptx4 C T 17: 25,122,722 T57I probably benign Het
Rchy1 A T 5: 91,957,537 C108* probably null Het
Rif1 A G 2: 52,111,850 E130G probably benign Het
Rmdn1 A T 4: 19,601,385 Y219F probably damaging Het
Rnf144a A G 12: 26,327,607 C46R probably damaging Het
Rpl13a C A 7: 45,126,203 G146V probably damaging Het
Rpl13a C A 7: 45,126,204 G146W probably damaging Het
Rtn3 A T 19: 7,457,489 N379K probably damaging Het
Sdc1 G T 12: 8,771,817 R19L unknown Het
Shank1 A G 7: 44,334,046 I651V unknown Het
Slamf6 T C 1: 171,936,703 V221A probably benign Het
Soga3 A T 10: 29,196,331 K540* probably null Het
Sp9 C A 2: 73,273,495 S131* probably null Het
Spen T C 4: 141,475,632 T1895A possibly damaging Het
Taf6l CGCAGCCGCACCTG CG 19: 8,774,324 probably benign Het
Thada G T 17: 84,441,744 H600N possibly damaging Het
Trmt11 G T 10: 30,547,757 P384Q probably damaging Het
Tsnaxip1 T C 8: 105,840,027 L165P probably damaging Het
Ttc7 A G 17: 87,330,074 Y419C probably damaging Het
Ugt1a6a T C 1: 88,138,838 F122S probably benign Het
Vmn1r218 G A 13: 23,136,654 C57Y probably benign Het
Vmn2r14 T C 5: 109,221,422 N95S probably damaging Het
Vmn2r2 G T 3: 64,126,600 H500Q probably benign Het
Vmn2r70 T A 7: 85,559,034 Y745F probably damaging Het
Zfp189 C T 4: 49,530,193 S432F probably benign Het
Zscan2 C T 7: 80,863,273 A2V probably damaging Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120388264 missense probably damaging 1.00
IGL02108:Myrip APN 9 120467565 critical splice donor site probably null
IGL02406:Myrip APN 9 120467532 missense probably benign
IGL02876:Myrip APN 9 120432674 missense probably damaging 1.00
IGL03109:Myrip APN 9 120453724 splice site probably null
IGL03258:Myrip APN 9 120441352 missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120467517 missense probably damaging 0.98
R0485:Myrip UTSW 9 120441377 missense probably benign 0.01
R0633:Myrip UTSW 9 120388236 missense probably damaging 1.00
R1489:Myrip UTSW 9 120432529 missense probably damaging 1.00
R1539:Myrip UTSW 9 120424623 missense probably benign 0.00
R1708:Myrip UTSW 9 120464774 missense possibly damaging 0.65
R1817:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1818:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1878:Myrip UTSW 9 120424655 missense probably damaging 0.99
R2484:Myrip UTSW 9 120424619 missense probably benign 0.00
R3237:Myrip UTSW 9 120441407 missense possibly damaging 0.91
R3890:Myrip UTSW 9 120422258 missense probably damaging 1.00
R3912:Myrip UTSW 9 120432616 missense probably benign
R3919:Myrip UTSW 9 120432629 missense probably damaging 1.00
R4125:Myrip UTSW 9 120464698 nonsense probably null
R4126:Myrip UTSW 9 120464698 nonsense probably null
R4128:Myrip UTSW 9 120464698 nonsense probably null
R4435:Myrip UTSW 9 120335614 start gained probably benign
R4599:Myrip UTSW 9 120464784 missense probably damaging 0.97
R5014:Myrip UTSW 9 120422468 missense probably damaging 1.00
R5665:Myrip UTSW 9 120461433 missense probably damaging 1.00
R5814:Myrip UTSW 9 120424668 missense probably benign 0.06
R5849:Myrip UTSW 9 120453693 missense probably damaging 0.99
R5986:Myrip UTSW 9 120461421 missense probably damaging 1.00
R6706:Myrip UTSW 9 120388293 missense possibly damaging 0.93
R7019:Myrip UTSW 9 120422507 missense probably damaging 1.00
R7291:Myrip UTSW 9 120417141 missense probably damaging 0.97
R8204:Myrip UTSW 9 120432979 critical splice donor site probably null
R8557:Myrip UTSW 9 120417186 missense probably benign 0.32
R8853:Myrip UTSW 9 120461421 missense probably damaging 1.00
R8911:Myrip UTSW 9 120441418 missense possibly damaging 0.94
R9106:Myrip UTSW 9 120432478 missense probably benign 0.37
Z1177:Myrip UTSW 9 120432778 missense probably benign
Z1177:Myrip UTSW 9 120441481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCATTGTAGCGGTGGATAGAC -3'
(R):5'- AAGTGCAACATACCTTTCACAG -3'

Sequencing Primer
(F):5'- GTGTTGAAGTGCACACCTGTAATCC -3'
(R):5'- CTTTCACAGGAGGGGCAG -3'
Posted On 2022-02-07