Incidental Mutation 'R9226:Usp20'
ID 699839
Institutional Source Beutler Lab
Gene Symbol Usp20
Ensembl Gene ENSMUSG00000026854
Gene Name ubiquitin specific peptidase 20
Synonyms 1700055M05Rik, Vdu2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9226 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 30982279-31023586 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 31017400 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 648 (A648D)
Ref Sequence ENSEMBL: ENSMUSP00000099913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102849] [ENSMUST00000170476]
AlphaFold Q8C6M1
Predicted Effect probably damaging
Transcript: ENSMUST00000102849
AA Change: A648D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099913
Gene: ENSMUSG00000026854
AA Change: A648D

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 4.3e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 684 5e-63 PFAM
Pfam:UCH_1 145 669 8.8e-24 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170476
AA Change: A648D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127388
Gene: ENSMUSG00000026854
AA Change: A648D

DomainStartEndE-ValueType
Pfam:zf-UBP 30 95 3.4e-17 PFAM
low complexity region 128 138 N/A INTRINSIC
Pfam:UCH 144 270 1.2e-26 PFAM
Pfam:UCH_1 145 669 6.1e-20 PFAM
Pfam:UCH 324 684 1.6e-31 PFAM
DUSP 704 787 5.97e-28 SMART
DUSP 812 897 4.74e-31 SMART
Meta Mutation Damage Score 0.8011 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin specific processing protease that was first identified as a substrate of the VHL (von Hippel-Lindau disease) protein E3 ubiquitin ligase complex. In addition to being ubiquitinated by the VHL-E3 ligase complex, this enzyme deubiquitinates hypoxia-inducible factor (HIF)-1 alpha and thereby causes increased expression of HIF-1alpha targeted genes which play a role in angiogenesis, glucose metabolism, cell proliferation and metastasis. The enzyme encoded by this gene also regulates G-protein coupled receptor signaling by mediating the deubiquitination of beta-2 adrenergic receptor (ADRB2). This enzyme is a ubiquitously expressed thiolester hydrolase. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,659 M1L probably benign Het
Adgrf4 C A 17: 42,669,715 A160S probably damaging Het
Adgrl1 T C 8: 83,929,797 V243A possibly damaging Het
Adgrl4 G T 3: 151,492,427 probably null Het
Alg8 A G 7: 97,378,216 Y97C probably damaging Het
Ankrd12 T A 17: 65,985,759 D893V probably damaging Het
Anxa6 T A 11: 54,994,965 T385S probably benign Het
Art4 A T 6: 136,854,367 C259S probably damaging Het
Ccer2 T C 7: 28,757,136 S102P possibly damaging Het
Cdhr3 A G 12: 33,082,321 F101S probably damaging Het
Ctdsp1 G T 1: 74,395,576 G260W probably damaging Het
Cyp24a1 T C 2: 170,496,357 Y89C probably damaging Het
Cyp2d34 T C 15: 82,620,700 D53G probably damaging Het
Dnah7a A C 1: 53,521,167 I2115S possibly damaging Het
Exoc4 T A 6: 33,918,424 I792N possibly damaging Het
Gm4353 A G 7: 116,083,771 F192L probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Ift140 T C 17: 25,098,865 V1441A probably benign Het
Ighv1-49 A T 12: 115,055,453 C41S probably damaging Het
Lgalsl A T 11: 20,829,306 I113N possibly damaging Het
Lrp1b T C 2: 41,511,448 D398G Het
Lrrc4b A G 7: 44,462,675 H657R possibly damaging Het
Map2k2 T C 10: 81,119,359 V228A possibly damaging Het
Mdn1 A G 4: 32,694,612 I1112V probably benign Het
Mipep T A 14: 60,831,243 M488K possibly damaging Het
Myo15b A G 11: 115,860,098 T565A Het
Nfat5 T C 8: 107,368,769 L1214P probably damaging Het
Nphp3 A G 9: 104,008,129 T223A probably benign Het
Olfr601 A G 7: 103,358,885 M103T probably damaging Het
Olfr982 A G 9: 40,074,891 I199V probably benign Het
Pkn2 G A 3: 142,793,948 R939W probably damaging Het
Pla2g4c T C 7: 13,325,746 C3R possibly damaging Het
Plxnd1 A T 6: 115,957,563 I1803N probably damaging Het
Pygb C A 2: 150,820,861 H583N possibly damaging Het
Rbm20 A G 19: 53,851,214 D878G possibly damaging Het
Rdx C A 9: 52,081,168 Q414K probably benign Het
Scara3 T C 14: 65,931,784 E128G possibly damaging Het
Sel1l2 T C 2: 140,255,302 Y361C probably damaging Het
Sfmbt2 T C 2: 10,438,049 I179T probably benign Het
Sgsm2 C T 11: 74,858,134 V567M possibly damaging Het
Sirt4 G A 5: 115,480,313 T234M probably damaging Het
Stab1 T G 14: 31,145,855 K1653Q probably benign Het
Strn4 T C 7: 16,825,797 probably benign Het
Stxbp5l C A 16: 37,255,844 S280I probably damaging Het
Tex30 G A 1: 44,086,973 R199W probably damaging Het
Tjp3 A C 10: 81,274,586 F731V probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmco3 A G 8: 13,310,143 probably null Het
Tmem94 C A 11: 115,792,365 A658E probably damaging Het
Tnxb T A 17: 34,685,792 L1177Q probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Upf2 T A 2: 6,047,034 V1169D unknown Het
Vmn2r108 T G 17: 20,471,068 N398H probably benign Het
Whamm A T 7: 81,593,907 S626C probably damaging Het
Zbtb44 A G 9: 31,064,228 S385G possibly damaging Het
Zfp580 C T 7: 5,053,138 Q166* probably null Het
Other mutations in Usp20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Usp20 APN 2 31004950 missense probably damaging 1.00
IGL01444:Usp20 APN 2 30998789 start codon destroyed probably null 1.00
IGL01601:Usp20 APN 2 31011794 missense probably benign 0.04
IGL01785:Usp20 APN 2 31017163 missense probably benign 0.02
IGL01786:Usp20 APN 2 31017163 missense probably benign 0.02
IGL02129:Usp20 APN 2 31004450 missense probably benign 0.43
IGL02147:Usp20 APN 2 31006401 missense probably damaging 1.00
IGL03396:Usp20 APN 2 31011717 missense probably benign
BB007:Usp20 UTSW 2 31010544 missense probably benign 0.21
BB017:Usp20 UTSW 2 31010544 missense probably benign 0.21
PIT4453001:Usp20 UTSW 2 31017486 missense possibly damaging 0.47
R0111:Usp20 UTSW 2 31002612 missense probably damaging 1.00
R0369:Usp20 UTSW 2 31011104 missense probably benign 0.00
R0479:Usp20 UTSW 2 31017475 missense probably benign 0.18
R0538:Usp20 UTSW 2 31004450 missense probably damaging 0.99
R1023:Usp20 UTSW 2 31007813 missense probably damaging 1.00
R1183:Usp20 UTSW 2 31011785 missense probably benign 0.17
R1635:Usp20 UTSW 2 31018818 missense probably benign 0.03
R2114:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2115:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2116:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2117:Usp20 UTSW 2 31016305 missense probably damaging 1.00
R2232:Usp20 UTSW 2 31018738 missense probably benign 0.13
R2244:Usp20 UTSW 2 31010331 missense possibly damaging 0.65
R2883:Usp20 UTSW 2 31018800 missense probably benign
R4734:Usp20 UTSW 2 31019824 missense probably benign 0.31
R5507:Usp20 UTSW 2 31010226 missense probably benign
R5770:Usp20 UTSW 2 31017508 missense probably damaging 1.00
R5862:Usp20 UTSW 2 31006449 nonsense probably null
R6315:Usp20 UTSW 2 31017758 missense possibly damaging 0.70
R7603:Usp20 UTSW 2 31011474 missense probably damaging 1.00
R7887:Usp20 UTSW 2 31020894 missense probably benign 0.34
R7930:Usp20 UTSW 2 31010544 missense probably benign 0.21
R8542:Usp20 UTSW 2 31011624 missense possibly damaging 0.94
R8965:Usp20 UTSW 2 31011785 missense possibly damaging 0.77
R9079:Usp20 UTSW 2 31005108 intron probably benign
R9417:Usp20 UTSW 2 30983018 critical splice acceptor site probably null
R9459:Usp20 UTSW 2 31011012 missense probably damaging 0.99
Z1176:Usp20 UTSW 2 31019818 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTCTGGCCAAGGAGTGCAC -3'
(R):5'- TTGTGCATGGACACAAGCC -3'

Sequencing Primer
(F):5'- AAGGAGTGCACGTCCCAG -3'
(R):5'- TTTAGCATGCTGGGACACCAC -3'
Posted On 2022-02-07