Incidental Mutation 'R9226:Mdn1'
ID 699846
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Name midasin AAA ATPase 1
Synonyms 4833432B22Rik, D4Abb1e, LOC213784
MMRRC Submission 068960-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9226 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 32657119-32775217 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32694612 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1112 (I1112V)
Ref Sequence ENSEMBL: ENSMUSP00000071569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000071642
AA Change: I1112V

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: I1112V

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178134
AA Change: I1112V

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: I1112V

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (57/57)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,118,518 (GRCm39) M1L probably benign Het
Adgrf4 C A 17: 42,980,606 (GRCm39) A160S probably damaging Het
Adgrl1 T C 8: 84,656,426 (GRCm39) V243A possibly damaging Het
Adgrl4 G T 3: 151,198,064 (GRCm39) probably null Het
Alg8 A G 7: 97,027,423 (GRCm39) Y97C probably damaging Het
Ankrd12 T A 17: 66,292,754 (GRCm39) D893V probably damaging Het
Anxa6 T A 11: 54,885,791 (GRCm39) T385S probably benign Het
Art4 A T 6: 136,831,365 (GRCm39) C259S probably damaging Het
Ccer2 T C 7: 28,456,561 (GRCm39) S102P possibly damaging Het
Cdhr3 A G 12: 33,132,320 (GRCm39) F101S probably damaging Het
Ctdsp1 G T 1: 74,434,735 (GRCm39) G260W probably damaging Het
Cyp24a1 T C 2: 170,338,277 (GRCm39) Y89C probably damaging Het
Cyp2d34 T C 15: 82,504,901 (GRCm39) D53G probably damaging Het
Dnah7a A C 1: 53,560,326 (GRCm39) I2115S possibly damaging Het
Exoc4 T A 6: 33,895,359 (GRCm39) I792N possibly damaging Het
Gm4353 A G 7: 115,683,006 (GRCm39) F192L probably damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Ift140 T C 17: 25,317,839 (GRCm39) V1441A probably benign Het
Ighv1-49 A T 12: 115,019,073 (GRCm39) C41S probably damaging Het
Lgalsl A T 11: 20,779,306 (GRCm39) I113N possibly damaging Het
Lrp1b T C 2: 41,401,460 (GRCm39) D398G Het
Lrrc4b A G 7: 44,112,099 (GRCm39) H657R possibly damaging Het
Map2k2 T C 10: 80,955,193 (GRCm39) V228A possibly damaging Het
Mipep T A 14: 61,068,692 (GRCm39) M488K possibly damaging Het
Myo15b A G 11: 115,750,924 (GRCm39) T565A Het
Nfat5 T C 8: 108,095,401 (GRCm39) L1214P probably damaging Het
Nphp3 A G 9: 103,885,328 (GRCm39) T223A probably benign Het
Or10s1 A G 9: 39,986,187 (GRCm39) I199V probably benign Het
Or52s19 A G 7: 103,008,092 (GRCm39) M103T probably damaging Het
Pkn2 G A 3: 142,499,709 (GRCm39) R939W probably damaging Het
Pla2g4c T C 7: 13,059,671 (GRCm39) C3R possibly damaging Het
Plxnd1 A T 6: 115,934,524 (GRCm39) I1803N probably damaging Het
Pygb C A 2: 150,662,781 (GRCm39) H583N possibly damaging Het
Rbm20 A G 19: 53,839,645 (GRCm39) D878G possibly damaging Het
Rdx C A 9: 51,992,468 (GRCm39) Q414K probably benign Het
Scara3 T C 14: 66,169,233 (GRCm39) E128G possibly damaging Het
Sel1l2 T C 2: 140,097,222 (GRCm39) Y361C probably damaging Het
Sfmbt2 T C 2: 10,442,860 (GRCm39) I179T probably benign Het
Sgsm2 C T 11: 74,748,960 (GRCm39) V567M possibly damaging Het
Sirt4 G A 5: 115,618,372 (GRCm39) T234M probably damaging Het
Stab1 T G 14: 30,867,812 (GRCm39) K1653Q probably benign Het
Strn4 T C 7: 16,559,722 (GRCm39) probably benign Het
Stxbp5l C A 16: 37,076,206 (GRCm39) S280I probably damaging Het
Tex30 G A 1: 44,126,133 (GRCm39) R199W probably damaging Het
Tjp3 A C 10: 81,110,420 (GRCm39) F731V probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tmco3 A G 8: 13,360,143 (GRCm39) probably null Het
Tmem94 C A 11: 115,683,191 (GRCm39) A658E probably damaging Het
Tnxb T A 17: 34,904,766 (GRCm39) L1177Q probably damaging Het
Trim28 G A 7: 12,763,490 (GRCm39) A544T probably benign Het
Upf2 T A 2: 6,051,845 (GRCm39) V1169D unknown Het
Usp20 C A 2: 30,907,412 (GRCm39) A648D probably damaging Het
Vmn2r108 T G 17: 20,691,330 (GRCm39) N398H probably benign Het
Whamm A T 7: 81,243,655 (GRCm39) S626C probably damaging Het
Zbtb44 A G 9: 30,975,524 (GRCm39) S385G possibly damaging Het
Zfp580 C T 7: 5,056,137 (GRCm39) Q166* probably null Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32,723,651 (GRCm39) missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32,719,214 (GRCm39) missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32,735,719 (GRCm39) missense probably benign
IGL00573:Mdn1 APN 4 32,666,619 (GRCm39) critical splice donor site probably null
IGL00983:Mdn1 APN 4 32,735,525 (GRCm39) missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32,730,864 (GRCm39) missense probably benign 0.00
IGL01359:Mdn1 APN 4 32,743,686 (GRCm39) missense probably benign 0.10
IGL01457:Mdn1 APN 4 32,715,922 (GRCm39) missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32,711,938 (GRCm39) splice site probably benign
IGL01684:Mdn1 APN 4 32,726,857 (GRCm39) missense probably benign
IGL01753:Mdn1 APN 4 32,708,483 (GRCm39) missense probably benign
IGL01901:Mdn1 APN 4 32,669,591 (GRCm39) missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32,723,657 (GRCm39) missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32,758,393 (GRCm39) missense probably benign 0.14
IGL02019:Mdn1 APN 4 32,749,948 (GRCm39) missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32,715,708 (GRCm39) missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32,709,364 (GRCm39) missense probably benign 0.00
IGL02154:Mdn1 APN 4 32,740,395 (GRCm39) missense probably benign 0.35
IGL02216:Mdn1 APN 4 32,739,092 (GRCm39) missense probably benign 0.03
IGL02371:Mdn1 APN 4 32,676,860 (GRCm39) splice site probably benign
IGL02396:Mdn1 APN 4 32,700,120 (GRCm39) missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32,694,674 (GRCm39) critical splice donor site probably null
IGL02502:Mdn1 APN 4 32,670,579 (GRCm39) missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32,763,199 (GRCm39) missense probably benign 0.05
IGL02946:Mdn1 APN 4 32,734,366 (GRCm39) missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32,713,360 (GRCm39) splice site probably benign
IGL03076:Mdn1 APN 4 32,735,564 (GRCm39) missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32,729,994 (GRCm39) missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32,732,842 (GRCm39) missense probably benign 0.06
3-1:Mdn1 UTSW 4 32,725,967 (GRCm39) critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32,694,495 (GRCm39) missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32,749,934 (GRCm39) missense probably benign 0.05
PIT4508001:Mdn1 UTSW 4 32,719,223 (GRCm39) missense probably damaging 0.97
PIT4618001:Mdn1 UTSW 4 32,746,527 (GRCm39) missense probably benign 0.20
R0008:Mdn1 UTSW 4 32,718,317 (GRCm39) missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32,738,619 (GRCm39) missense probably benign 0.20
R0125:Mdn1 UTSW 4 32,729,956 (GRCm39) missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32,693,534 (GRCm39) missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32,741,835 (GRCm39) missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32,750,318 (GRCm39) missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32,746,439 (GRCm39) critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32,684,707 (GRCm39) missense probably benign 0.39
R0450:Mdn1 UTSW 4 32,738,619 (GRCm39) missense probably benign 0.20
R0465:Mdn1 UTSW 4 32,699,204 (GRCm39) splice site probably benign
R0469:Mdn1 UTSW 4 32,738,619 (GRCm39) missense probably benign 0.20
R0477:Mdn1 UTSW 4 32,750,928 (GRCm39) missense probably benign 0.02
R0481:Mdn1 UTSW 4 32,767,182 (GRCm39) splice site probably benign
R0504:Mdn1 UTSW 4 32,698,916 (GRCm39) splice site probably benign
R0522:Mdn1 UTSW 4 32,672,837 (GRCm39) missense probably benign 0.09
R0550:Mdn1 UTSW 4 32,730,479 (GRCm39) missense probably benign 0.13
R0607:Mdn1 UTSW 4 32,732,829 (GRCm39) missense probably benign 0.36
R0607:Mdn1 UTSW 4 32,712,014 (GRCm39) missense probably damaging 1.00
R0664:Mdn1 UTSW 4 32,768,011 (GRCm39) nonsense probably null
R0701:Mdn1 UTSW 4 32,699,263 (GRCm39) missense probably benign 0.00
R0801:Mdn1 UTSW 4 32,668,895 (GRCm39) missense probably benign 0.04
R0841:Mdn1 UTSW 4 32,752,032 (GRCm39) missense probably benign 0.23
R0849:Mdn1 UTSW 4 32,741,835 (GRCm39) missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32,701,713 (GRCm39) missense probably benign 0.01
R1114:Mdn1 UTSW 4 32,746,568 (GRCm39) critical splice donor site probably null
R1137:Mdn1 UTSW 4 32,694,511 (GRCm39) missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32,735,576 (GRCm39) missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32,735,576 (GRCm39) missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32,735,576 (GRCm39) missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32,667,089 (GRCm39) critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32,700,334 (GRCm39) splice site probably benign
R1466:Mdn1 UTSW 4 32,730,788 (GRCm39) missense probably benign 0.28
R1466:Mdn1 UTSW 4 32,730,788 (GRCm39) missense probably benign 0.28
R1518:Mdn1 UTSW 4 32,739,977 (GRCm39) missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32,723,501 (GRCm39) missense probably null 0.10
R1574:Mdn1 UTSW 4 32,722,315 (GRCm39) missense probably benign
R1574:Mdn1 UTSW 4 32,722,315 (GRCm39) missense probably benign
R1591:Mdn1 UTSW 4 32,700,092 (GRCm39) missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32,663,050 (GRCm39) missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32,700,417 (GRCm39) missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32,693,504 (GRCm39) missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32,773,952 (GRCm39) missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32,700,103 (GRCm39) missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32,720,761 (GRCm39) missense probably damaging 0.97
R1858:Mdn1 UTSW 4 32,730,881 (GRCm39) missense probably benign 0.17
R1870:Mdn1 UTSW 4 32,763,339 (GRCm39) missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32,742,540 (GRCm39) missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32,760,839 (GRCm39) small deletion probably benign
R2075:Mdn1 UTSW 4 32,716,058 (GRCm39) missense probably benign 0.03
R2103:Mdn1 UTSW 4 32,738,712 (GRCm39) missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32,743,843 (GRCm39) splice site probably null
R2110:Mdn1 UTSW 4 32,700,409 (GRCm39) missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32,700,409 (GRCm39) missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32,716,271 (GRCm39) missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32,763,306 (GRCm39) missense probably benign 0.37
R2240:Mdn1 UTSW 4 32,765,701 (GRCm39) missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32,750,010 (GRCm39) missense probably benign 0.21
R2421:Mdn1 UTSW 4 32,723,621 (GRCm39) missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32,750,013 (GRCm39) missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32,733,726 (GRCm39) critical splice donor site probably null
R3435:Mdn1 UTSW 4 32,733,726 (GRCm39) critical splice donor site probably null
R3783:Mdn1 UTSW 4 32,720,818 (GRCm39) missense probably benign 0.01
R3811:Mdn1 UTSW 4 32,693,506 (GRCm39) nonsense probably null
R3973:Mdn1 UTSW 4 32,722,363 (GRCm39) missense probably benign 0.00
R4154:Mdn1 UTSW 4 32,707,475 (GRCm39) missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32,743,809 (GRCm39) missense probably benign 0.03
R4393:Mdn1 UTSW 4 32,754,482 (GRCm39) missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32,704,635 (GRCm39) missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32,668,860 (GRCm39) missense probably benign 0.00
R4509:Mdn1 UTSW 4 32,715,883 (GRCm39) missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32,722,334 (GRCm39) missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32,754,437 (GRCm39) missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32,741,812 (GRCm39) missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32,707,636 (GRCm39) missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32,730,749 (GRCm39) splice site probably null
R4667:Mdn1 UTSW 4 32,679,572 (GRCm39) missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32,666,430 (GRCm39) missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32,683,583 (GRCm39) nonsense probably null
R4807:Mdn1 UTSW 4 32,685,651 (GRCm39) splice site probably null
R4923:Mdn1 UTSW 4 32,671,608 (GRCm39) missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32,707,459 (GRCm39) missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32,756,512 (GRCm39) missense probably benign 0.00
R4971:Mdn1 UTSW 4 32,739,827 (GRCm39) missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32,734,418 (GRCm39) missense probably benign 0.01
R5122:Mdn1 UTSW 4 32,670,593 (GRCm39) missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32,774,008 (GRCm39) missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32,759,011 (GRCm39) splice site probably null
R5215:Mdn1 UTSW 4 32,741,418 (GRCm39) missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32,723,690 (GRCm39) missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32,720,897 (GRCm39) missense probably benign
R5522:Mdn1 UTSW 4 32,685,783 (GRCm39) missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32,767,961 (GRCm39) missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32,728,167 (GRCm39) missense probably benign 0.04
R5605:Mdn1 UTSW 4 32,765,664 (GRCm39) missense probably benign
R5621:Mdn1 UTSW 4 32,716,371 (GRCm39) missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32,695,480 (GRCm39) missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32,667,467 (GRCm39) splice site probably null
R5780:Mdn1 UTSW 4 32,722,950 (GRCm39) missense probably benign 0.02
R5838:Mdn1 UTSW 4 32,754,547 (GRCm39) missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32,670,646 (GRCm39) missense probably benign 0.09
R5895:Mdn1 UTSW 4 32,695,400 (GRCm39) missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32,678,330 (GRCm39) missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32,741,073 (GRCm39) missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32,715,713 (GRCm39) missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32,689,581 (GRCm39) missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32,684,735 (GRCm39) missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32,716,040 (GRCm39) missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32,715,953 (GRCm39) missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32,696,269 (GRCm39) missense probably benign 0.12
R6249:Mdn1 UTSW 4 32,708,484 (GRCm39) missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32,748,590 (GRCm39) missense probably benign 0.13
R6253:Mdn1 UTSW 4 32,749,593 (GRCm39) missense probably benign 0.25
R6273:Mdn1 UTSW 4 32,715,979 (GRCm39) missense probably benign 0.01
R6297:Mdn1 UTSW 4 32,730,054 (GRCm39) nonsense probably null
R6384:Mdn1 UTSW 4 32,670,607 (GRCm39) missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32,773,308 (GRCm39) missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32,713,780 (GRCm39) missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32,774,041 (GRCm39) missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32,676,786 (GRCm39) missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32,741,893 (GRCm39) missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32,748,614 (GRCm39) missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32,774,041 (GRCm39) missense possibly damaging 0.74
R6980:Mdn1 UTSW 4 32,726,942 (GRCm39) critical splice donor site probably null
R6995:Mdn1 UTSW 4 32,733,374 (GRCm39) missense probably benign 0.03
R7048:Mdn1 UTSW 4 32,767,969 (GRCm39) missense probably benign 0.00
R7082:Mdn1 UTSW 4 32,762,341 (GRCm39) missense probably benign
R7158:Mdn1 UTSW 4 32,725,121 (GRCm39) missense probably benign 0.09
R7166:Mdn1 UTSW 4 32,746,446 (GRCm39) missense probably damaging 1.00
R7168:Mdn1 UTSW 4 32,719,184 (GRCm39) missense probably damaging 1.00
R7175:Mdn1 UTSW 4 32,694,634 (GRCm39) missense probably damaging 1.00
R7195:Mdn1 UTSW 4 32,701,823 (GRCm39) missense probably damaging 1.00
R7250:Mdn1 UTSW 4 32,695,427 (GRCm39) missense probably damaging 1.00
R7274:Mdn1 UTSW 4 32,725,944 (GRCm39) missense probably benign 0.12
R7330:Mdn1 UTSW 4 32,723,685 (GRCm39) missense probably benign 0.16
R7363:Mdn1 UTSW 4 32,691,729 (GRCm39) missense probably damaging 0.99
R7369:Mdn1 UTSW 4 32,773,375 (GRCm39) missense probably damaging 0.99
R7452:Mdn1 UTSW 4 32,739,030 (GRCm39) missense possibly damaging 0.87
R7523:Mdn1 UTSW 4 32,667,270 (GRCm39) critical splice acceptor site probably null
R7594:Mdn1 UTSW 4 32,696,359 (GRCm39) missense probably benign 0.27
R7605:Mdn1 UTSW 4 32,694,599 (GRCm39) missense probably damaging 1.00
R7661:Mdn1 UTSW 4 32,691,229 (GRCm39) missense probably benign 0.08
R7689:Mdn1 UTSW 4 32,739,912 (GRCm39) missense probably damaging 1.00
R7699:Mdn1 UTSW 4 32,741,344 (GRCm39) missense probably damaging 1.00
R7700:Mdn1 UTSW 4 32,741,344 (GRCm39) missense probably damaging 1.00
R7714:Mdn1 UTSW 4 32,722,360 (GRCm39) missense possibly damaging 0.75
R7718:Mdn1 UTSW 4 32,718,420 (GRCm39) missense probably damaging 1.00
R7762:Mdn1 UTSW 4 32,734,421 (GRCm39) missense probably benign
R7787:Mdn1 UTSW 4 32,741,794 (GRCm39) missense probably damaging 1.00
R8111:Mdn1 UTSW 4 32,674,003 (GRCm39) missense possibly damaging 0.81
R8222:Mdn1 UTSW 4 32,707,477 (GRCm39) missense probably benign 0.09
R8246:Mdn1 UTSW 4 32,657,284 (GRCm39) missense probably benign 0.06
R8267:Mdn1 UTSW 4 32,742,485 (GRCm39) missense possibly damaging 0.82
R8286:Mdn1 UTSW 4 32,731,960 (GRCm39) missense possibly damaging 0.91
R8305:Mdn1 UTSW 4 32,725,107 (GRCm39) missense probably benign
R8318:Mdn1 UTSW 4 32,735,897 (GRCm39) critical splice donor site probably null
R8379:Mdn1 UTSW 4 32,756,453 (GRCm39) missense probably null 1.00
R8384:Mdn1 UTSW 4 32,765,680 (GRCm39) missense probably benign 0.05
R8514:Mdn1 UTSW 4 32,739,857 (GRCm39) missense probably damaging 1.00
R8560:Mdn1 UTSW 4 32,743,830 (GRCm39) missense probably benign 0.08
R8672:Mdn1 UTSW 4 32,768,793 (GRCm39) missense probably damaging 1.00
R8708:Mdn1 UTSW 4 32,725,854 (GRCm39) missense probably damaging 1.00
R8769:Mdn1 UTSW 4 32,751,390 (GRCm39) missense probably damaging 0.97
R8896:Mdn1 UTSW 4 32,678,328 (GRCm39) missense probably benign 0.28
R8918:Mdn1 UTSW 4 32,744,579 (GRCm39) nonsense probably null
R8920:Mdn1 UTSW 4 32,719,280 (GRCm39) missense probably damaging 1.00
R8966:Mdn1 UTSW 4 32,672,837 (GRCm39) nonsense probably null
R8997:Mdn1 UTSW 4 32,773,275 (GRCm39) missense probably damaging 1.00
R9120:Mdn1 UTSW 4 32,701,814 (GRCm39) missense probably damaging 1.00
R9129:Mdn1 UTSW 4 32,676,812 (GRCm39) missense probably benign 0.24
R9131:Mdn1 UTSW 4 32,762,275 (GRCm39) missense possibly damaging 0.69
R9200:Mdn1 UTSW 4 32,760,791 (GRCm39) missense probably benign 0.00
R9235:Mdn1 UTSW 4 32,739,122 (GRCm39) missense probably benign 0.10
R9293:Mdn1 UTSW 4 32,707,579 (GRCm39) missense probably damaging 1.00
R9315:Mdn1 UTSW 4 32,760,911 (GRCm39) missense probably benign 0.00
R9338:Mdn1 UTSW 4 32,666,536 (GRCm39) missense probably benign 0.00
R9353:Mdn1 UTSW 4 32,693,504 (GRCm39) missense probably damaging 1.00
R9393:Mdn1 UTSW 4 32,713,825 (GRCm39) missense
R9420:Mdn1 UTSW 4 32,678,414 (GRCm39) missense probably damaging 1.00
R9475:Mdn1 UTSW 4 32,739,849 (GRCm39) missense possibly damaging 0.65
R9583:Mdn1 UTSW 4 32,741,372 (GRCm39) missense probably damaging 1.00
R9600:Mdn1 UTSW 4 32,684,723 (GRCm39) nonsense probably null
R9640:Mdn1 UTSW 4 32,754,539 (GRCm39) missense probably damaging 1.00
R9688:Mdn1 UTSW 4 32,745,590 (GRCm39) missense probably damaging 1.00
R9744:Mdn1 UTSW 4 32,715,711 (GRCm39) missense possibly damaging 0.91
X0066:Mdn1 UTSW 4 32,739,030 (GRCm39) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,696,244 (GRCm39) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,668,944 (GRCm39) missense probably damaging 1.00
Z1176:Mdn1 UTSW 4 32,667,102 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGATGCATGGTTACCTTGTGTACC -3'
(R):5'- ACAAAGGAATCCAGTGCTCTAGG -3'

Sequencing Primer
(F):5'- GCATGGTTACCTTGTGTACCTAAAAG -3'
(R):5'- GGAATCCAGTGCTCTAGGAATTACC -3'
Posted On 2022-02-07