Incidental Mutation 'R9226:Plxnd1'
ID 699851
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms b2b553Clo, 6230425C21Rik, b2b1863Clo
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9226 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 115954811-115995005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 115957563 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1803 (I1803N)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect probably damaging
Transcript: ENSMUST00000015511
AA Change: I1803N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: I1803N

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,659 M1L probably benign Het
Adgrf4 C A 17: 42,669,715 A160S probably damaging Het
Adgrl1 T C 8: 83,929,797 V243A possibly damaging Het
Adgrl4 G T 3: 151,492,427 probably null Het
Alg8 A G 7: 97,378,216 Y97C probably damaging Het
Ankrd12 T A 17: 65,985,759 D893V probably damaging Het
Anxa6 T A 11: 54,994,965 T385S probably benign Het
Art4 A T 6: 136,854,367 C259S probably damaging Het
Ccer2 T C 7: 28,757,136 S102P possibly damaging Het
Cdhr3 A G 12: 33,082,321 F101S probably damaging Het
Ctdsp1 G T 1: 74,395,576 G260W probably damaging Het
Cyp24a1 T C 2: 170,496,357 Y89C probably damaging Het
Cyp2d34 T C 15: 82,620,700 D53G probably damaging Het
Dnah7a A C 1: 53,521,167 I2115S possibly damaging Het
Exoc4 T A 6: 33,918,424 I792N possibly damaging Het
Gm4353 A G 7: 116,083,771 F192L probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Ift140 T C 17: 25,098,865 V1441A probably benign Het
Ighv1-49 A T 12: 115,055,453 C41S probably damaging Het
Lgalsl A T 11: 20,829,306 I113N possibly damaging Het
Lrp1b T C 2: 41,511,448 D398G Het
Lrrc4b A G 7: 44,462,675 H657R possibly damaging Het
Map2k2 T C 10: 81,119,359 V228A possibly damaging Het
Mdn1 A G 4: 32,694,612 I1112V probably benign Het
Mipep T A 14: 60,831,243 M488K possibly damaging Het
Myo15b A G 11: 115,860,098 T565A Het
Nfat5 T C 8: 107,368,769 L1214P probably damaging Het
Nphp3 A G 9: 104,008,129 T223A probably benign Het
Olfr601 A G 7: 103,358,885 M103T probably damaging Het
Olfr982 A G 9: 40,074,891 I199V probably benign Het
Pkn2 G A 3: 142,793,948 R939W probably damaging Het
Pla2g4c T C 7: 13,325,746 C3R possibly damaging Het
Pygb C A 2: 150,820,861 H583N possibly damaging Het
Rbm20 A G 19: 53,851,214 D878G possibly damaging Het
Rdx C A 9: 52,081,168 Q414K probably benign Het
Scara3 T C 14: 65,931,784 E128G possibly damaging Het
Sel1l2 T C 2: 140,255,302 Y361C probably damaging Het
Sfmbt2 T C 2: 10,438,049 I179T probably benign Het
Sgsm2 C T 11: 74,858,134 V567M possibly damaging Het
Sirt4 G A 5: 115,480,313 T234M probably damaging Het
Stab1 T G 14: 31,145,855 K1653Q probably benign Het
Strn4 T C 7: 16,825,797 probably benign Het
Stxbp5l C A 16: 37,255,844 S280I probably damaging Het
Tex30 G A 1: 44,086,973 R199W probably damaging Het
Tjp3 A C 10: 81,274,586 F731V probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmco3 A G 8: 13,310,143 probably null Het
Tmem94 C A 11: 115,792,365 A658E probably damaging Het
Tnxb T A 17: 34,685,792 L1177Q probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Upf2 T A 2: 6,047,034 V1169D unknown Het
Usp20 C A 2: 31,017,400 A648D probably damaging Het
Vmn2r108 T G 17: 20,471,068 N398H probably benign Het
Whamm A T 7: 81,593,907 S626C probably damaging Het
Zbtb44 A G 9: 31,064,228 S385G possibly damaging Het
Zfp580 C T 7: 5,053,138 Q166* probably null Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
Hiss UTSW 6 115969929 missense possibly damaging 0.94
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
rattle UTSW 6 115959794 missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115962807 missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115957597 missense probably damaging 1.00
R8963:Plxnd1 UTSW 6 115972545 nonsense probably null
R9119:Plxnd1 UTSW 6 115955871 splice site probably benign
R9177:Plxnd1 UTSW 6 115966508 missense probably benign 0.00
R9182:Plxnd1 UTSW 6 115993785 missense probably damaging 0.98
R9185:Plxnd1 UTSW 6 115957565 missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115955769 missense probably damaging 1.00
R9451:Plxnd1 UTSW 6 115963316 missense possibly damaging 0.72
R9599:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9627:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9644:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTCTTCTCAGAAGGCCTTTATGG -3'
(R):5'- GACCAGCATTGTCTACCTCC -3'

Sequencing Primer
(F):5'- ACTGAACCGGCATATCCTCTG -3'
(R):5'- AGCATTGTCTACCTCCCCAGC -3'
Posted On 2022-02-07