Incidental Mutation 'R9226:Rdx'
ID 699867
Institutional Source Beutler Lab
Gene Symbol Rdx
Ensembl Gene ENSMUSG00000032050
Gene Name radixin
Synonyms
MMRRC Submission 068960-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9226 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 51958450-52000038 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 51992468 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 414 (Q414K)
Ref Sequence ENSEMBL: ENSMUSP00000000590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000590] [ENSMUST00000163153]
AlphaFold P26043
Predicted Effect probably benign
Transcript: ENSMUST00000000590
AA Change: Q414K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000000590
Gene: ENSMUSG00000032050
AA Change: Q414K

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 6e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163153
AA Change: Q414K

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000128249
Gene: ENSMUSG00000032050
AA Change: Q414K

DomainStartEndE-ValueType
B41 1 206 4.99e-82 SMART
FERM_C 210 299 1.43e-35 SMART
Pfam:ERM 338 583 3.4e-78 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a targeted mutation display mild degenerative changes in the liver and hyperbilirubinemia. Adult homozygotes exhibit profound deafness, but not imbalance, associated with progressive degeneration of stereocilia of cochlear hair cells after the onset of hearing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,118,518 (GRCm39) M1L probably benign Het
Adgrf4 C A 17: 42,980,606 (GRCm39) A160S probably damaging Het
Adgrl1 T C 8: 84,656,426 (GRCm39) V243A possibly damaging Het
Adgrl4 G T 3: 151,198,064 (GRCm39) probably null Het
Alg8 A G 7: 97,027,423 (GRCm39) Y97C probably damaging Het
Ankrd12 T A 17: 66,292,754 (GRCm39) D893V probably damaging Het
Anxa6 T A 11: 54,885,791 (GRCm39) T385S probably benign Het
Art4 A T 6: 136,831,365 (GRCm39) C259S probably damaging Het
Ccer2 T C 7: 28,456,561 (GRCm39) S102P possibly damaging Het
Cdhr3 A G 12: 33,132,320 (GRCm39) F101S probably damaging Het
Ctdsp1 G T 1: 74,434,735 (GRCm39) G260W probably damaging Het
Cyp24a1 T C 2: 170,338,277 (GRCm39) Y89C probably damaging Het
Cyp2d34 T C 15: 82,504,901 (GRCm39) D53G probably damaging Het
Dnah7a A C 1: 53,560,326 (GRCm39) I2115S possibly damaging Het
Exoc4 T A 6: 33,895,359 (GRCm39) I792N possibly damaging Het
Gm4353 A G 7: 115,683,006 (GRCm39) F192L probably damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Ift140 T C 17: 25,317,839 (GRCm39) V1441A probably benign Het
Ighv1-49 A T 12: 115,019,073 (GRCm39) C41S probably damaging Het
Lgalsl A T 11: 20,779,306 (GRCm39) I113N possibly damaging Het
Lrp1b T C 2: 41,401,460 (GRCm39) D398G Het
Lrrc4b A G 7: 44,112,099 (GRCm39) H657R possibly damaging Het
Map2k2 T C 10: 80,955,193 (GRCm39) V228A possibly damaging Het
Mdn1 A G 4: 32,694,612 (GRCm39) I1112V probably benign Het
Mipep T A 14: 61,068,692 (GRCm39) M488K possibly damaging Het
Myo15b A G 11: 115,750,924 (GRCm39) T565A Het
Nfat5 T C 8: 108,095,401 (GRCm39) L1214P probably damaging Het
Nphp3 A G 9: 103,885,328 (GRCm39) T223A probably benign Het
Or10s1 A G 9: 39,986,187 (GRCm39) I199V probably benign Het
Or52s19 A G 7: 103,008,092 (GRCm39) M103T probably damaging Het
Pkn2 G A 3: 142,499,709 (GRCm39) R939W probably damaging Het
Pla2g4c T C 7: 13,059,671 (GRCm39) C3R possibly damaging Het
Plxnd1 A T 6: 115,934,524 (GRCm39) I1803N probably damaging Het
Pygb C A 2: 150,662,781 (GRCm39) H583N possibly damaging Het
Rbm20 A G 19: 53,839,645 (GRCm39) D878G possibly damaging Het
Scara3 T C 14: 66,169,233 (GRCm39) E128G possibly damaging Het
Sel1l2 T C 2: 140,097,222 (GRCm39) Y361C probably damaging Het
Sfmbt2 T C 2: 10,442,860 (GRCm39) I179T probably benign Het
Sgsm2 C T 11: 74,748,960 (GRCm39) V567M possibly damaging Het
Sirt4 G A 5: 115,618,372 (GRCm39) T234M probably damaging Het
Stab1 T G 14: 30,867,812 (GRCm39) K1653Q probably benign Het
Strn4 T C 7: 16,559,722 (GRCm39) probably benign Het
Stxbp5l C A 16: 37,076,206 (GRCm39) S280I probably damaging Het
Tex30 G A 1: 44,126,133 (GRCm39) R199W probably damaging Het
Tjp3 A C 10: 81,110,420 (GRCm39) F731V probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tmco3 A G 8: 13,360,143 (GRCm39) probably null Het
Tmem94 C A 11: 115,683,191 (GRCm39) A658E probably damaging Het
Tnxb T A 17: 34,904,766 (GRCm39) L1177Q probably damaging Het
Trim28 G A 7: 12,763,490 (GRCm39) A544T probably benign Het
Upf2 T A 2: 6,051,845 (GRCm39) V1169D unknown Het
Usp20 C A 2: 30,907,412 (GRCm39) A648D probably damaging Het
Vmn2r108 T G 17: 20,691,330 (GRCm39) N398H probably benign Het
Whamm A T 7: 81,243,655 (GRCm39) S626C probably damaging Het
Zbtb44 A G 9: 30,975,524 (GRCm39) S385G possibly damaging Het
Zfp580 C T 7: 5,056,137 (GRCm39) Q166* probably null Het
Other mutations in Rdx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Rdx APN 9 51,997,646 (GRCm39) missense probably damaging 1.00
IGL02088:Rdx APN 9 51,972,183 (GRCm39) utr 5 prime probably benign
IGL02522:Rdx APN 9 51,979,504 (GRCm39) missense possibly damaging 0.92
R0731:Rdx UTSW 9 51,979,518 (GRCm39) missense probably benign 0.05
R0748:Rdx UTSW 9 51,976,160 (GRCm39) missense possibly damaging 0.87
R0831:Rdx UTSW 9 51,977,117 (GRCm39) missense probably damaging 1.00
R1605:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R1688:Rdx UTSW 9 51,972,211 (GRCm39) splice site probably benign
R2127:Rdx UTSW 9 51,981,032 (GRCm39) missense possibly damaging 0.49
R2363:Rdx UTSW 9 51,980,173 (GRCm39) missense probably damaging 1.00
R2899:Rdx UTSW 9 51,980,211 (GRCm39) splice site probably benign
R4184:Rdx UTSW 9 51,978,680 (GRCm39) missense probably damaging 1.00
R4569:Rdx UTSW 9 51,980,141 (GRCm39) missense probably benign 0.07
R4607:Rdx UTSW 9 51,980,137 (GRCm39) missense probably damaging 0.99
R4760:Rdx UTSW 9 51,977,174 (GRCm39) missense probably benign 0.02
R4820:Rdx UTSW 9 51,974,891 (GRCm39) missense probably damaging 1.00
R4966:Rdx UTSW 9 51,986,309 (GRCm39) missense probably benign 0.00
R6707:Rdx UTSW 9 51,974,954 (GRCm39) missense probably damaging 1.00
R7136:Rdx UTSW 9 51,997,745 (GRCm39) missense probably damaging 1.00
R7308:Rdx UTSW 9 51,980,170 (GRCm39) missense probably damaging 0.98
R7597:Rdx UTSW 9 51,972,196 (GRCm39) missense possibly damaging 0.84
R7835:Rdx UTSW 9 51,977,088 (GRCm39) missense probably damaging 0.98
R7923:Rdx UTSW 9 51,977,201 (GRCm39) missense possibly damaging 0.93
R8055:Rdx UTSW 9 51,997,724 (GRCm39) missense probably damaging 1.00
R8057:Rdx UTSW 9 51,976,946 (GRCm39) missense probably damaging 1.00
R8889:Rdx UTSW 9 51,997,753 (GRCm39) missense probably damaging 1.00
R8983:Rdx UTSW 9 51,974,905 (GRCm39) missense probably damaging 1.00
R9128:Rdx UTSW 9 51,976,179 (GRCm39) nonsense probably null
R9377:Rdx UTSW 9 51,980,168 (GRCm39) missense possibly damaging 0.83
R9469:Rdx UTSW 9 51,977,069 (GRCm39) missense probably damaging 1.00
R9534:Rdx UTSW 9 51,984,482 (GRCm39) nonsense probably null
R9746:Rdx UTSW 9 51,974,878 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACGAGGATGATTGCAGTTAACC -3'
(R):5'- ACATGGACCCTTTTATTCTGTTTGG -3'

Sequencing Primer
(F):5'- GATGATTGCAGTTAACCCATGTTTG -3'
(R):5'- GGACCCTTTTATTCTGTTTGGTTTTC -3'
Posted On 2022-02-07