Incidental Mutation 'R9226:Nphp3'
ID 699868
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Name nephronophthisis 3 (adolescent)
Synonyms 3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9226 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 104002544-104043818 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104008129 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 223 (T223A)
Ref Sequence ENSEMBL: ENSMUSP00000035167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]
AlphaFold Q7TNH6
Predicted Effect probably benign
Transcript: ENSMUST00000035167
AA Change: T223A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: T223A

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193439
AA Change: T129A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558
AA Change: T129A

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: T103A

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,659 M1L probably benign Het
Adgrf4 C A 17: 42,669,715 A160S probably damaging Het
Adgrl1 T C 8: 83,929,797 V243A possibly damaging Het
Adgrl4 G T 3: 151,492,427 probably null Het
Alg8 A G 7: 97,378,216 Y97C probably damaging Het
Ankrd12 T A 17: 65,985,759 D893V probably damaging Het
Anxa6 T A 11: 54,994,965 T385S probably benign Het
Art4 A T 6: 136,854,367 C259S probably damaging Het
Ccer2 T C 7: 28,757,136 S102P possibly damaging Het
Cdhr3 A G 12: 33,082,321 F101S probably damaging Het
Ctdsp1 G T 1: 74,395,576 G260W probably damaging Het
Cyp24a1 T C 2: 170,496,357 Y89C probably damaging Het
Cyp2d34 T C 15: 82,620,700 D53G probably damaging Het
Dnah7a A C 1: 53,521,167 I2115S possibly damaging Het
Exoc4 T A 6: 33,918,424 I792N possibly damaging Het
Gm4353 A G 7: 116,083,771 F192L probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Ift140 T C 17: 25,098,865 V1441A probably benign Het
Ighv1-49 A T 12: 115,055,453 C41S probably damaging Het
Lgalsl A T 11: 20,829,306 I113N possibly damaging Het
Lrp1b T C 2: 41,511,448 D398G Het
Lrrc4b A G 7: 44,462,675 H657R possibly damaging Het
Map2k2 T C 10: 81,119,359 V228A possibly damaging Het
Mdn1 A G 4: 32,694,612 I1112V probably benign Het
Mipep T A 14: 60,831,243 M488K possibly damaging Het
Myo15b A G 11: 115,860,098 T565A Het
Nfat5 T C 8: 107,368,769 L1214P probably damaging Het
Olfr601 A G 7: 103,358,885 M103T probably damaging Het
Olfr982 A G 9: 40,074,891 I199V probably benign Het
Pkn2 G A 3: 142,793,948 R939W probably damaging Het
Pla2g4c T C 7: 13,325,746 C3R possibly damaging Het
Plxnd1 A T 6: 115,957,563 I1803N probably damaging Het
Pygb C A 2: 150,820,861 H583N possibly damaging Het
Rbm20 A G 19: 53,851,214 D878G possibly damaging Het
Rdx C A 9: 52,081,168 Q414K probably benign Het
Scara3 T C 14: 65,931,784 E128G possibly damaging Het
Sel1l2 T C 2: 140,255,302 Y361C probably damaging Het
Sfmbt2 T C 2: 10,438,049 I179T probably benign Het
Sgsm2 C T 11: 74,858,134 V567M possibly damaging Het
Sirt4 G A 5: 115,480,313 T234M probably damaging Het
Stab1 T G 14: 31,145,855 K1653Q probably benign Het
Stxbp5l C A 16: 37,255,844 S280I probably damaging Het
Tex30 G A 1: 44,086,973 R199W probably damaging Het
Tjp3 A C 10: 81,274,586 F731V probably damaging Het
Tmco3 A G 8: 13,310,143 probably null Het
Tmem94 C A 11: 115,792,365 A658E probably damaging Het
Tnxb T A 17: 34,685,792 L1177Q probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Upf2 T A 2: 6,047,034 V1169D unknown Het
Usp20 C A 2: 31,017,400 A648D probably damaging Het
Vmn2r108 T G 17: 20,471,068 N398H probably benign Het
Whamm A T 7: 81,593,907 S626C probably damaging Het
Zbtb44 A G 9: 31,064,228 S385G possibly damaging Het
Zfp580 C T 7: 5,053,138 Q166* probably null Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7665:Nphp3 UTSW 9 104005393 splice site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
R8039:Nphp3 UTSW 9 104031963 missense probably benign
R8145:Nphp3 UTSW 9 104035851 missense probably benign 0.16
R8211:Nphp3 UTSW 9 104031897 missense possibly damaging 0.80
R8882:Nphp3 UTSW 9 104005594 missense possibly damaging 0.77
R9020:Nphp3 UTSW 9 104031951 missense probably benign 0.00
R9132:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9135:Nphp3 UTSW 9 104032015 missense probably damaging 0.99
R9159:Nphp3 UTSW 9 104020781 missense probably damaging 1.00
R9204:Nphp3 UTSW 9 104042106 missense probably benign
R9229:Nphp3 UTSW 9 104036177 missense probably damaging 1.00
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTCTGCCAAAAGTCAGTGC -3'
(R):5'- GAACACTAGTGTCATGCTACGTTG -3'

Sequencing Primer
(F):5'- TCTGCCAAAAGTCAGTGCCAAAATG -3'
(R):5'- GTCATGCTACGTTGCACAAG -3'
Posted On 2022-02-07