Incidental Mutation 'R9226:Stxbp5l'
ID 699882
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Name syntaxin binding protein 5-like
Synonyms insulin level locus 1, T2dm1, LLGL4, tomosyn-2, t2md1, A830015P08Rik
MMRRC Submission 068960-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9226 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 36935304-37205324 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 37076206 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Isoleucine at position 280 (S280I)
Ref Sequence ENSEMBL: ENSMUSP00000110423 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114775] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
AlphaFold Q5DQR4
Predicted Effect probably damaging
Transcript: ENSMUST00000114775
AA Change: S280I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110423
Gene: ENSMUSG00000022829
AA Change: S280I

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 3.5e-45 PFAM
Blast:WD40 397 466 6e-43 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114780
AA Change: S280I

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829
AA Change: S280I

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114781
AA Change: S280I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829
AA Change: S280I

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114782
AA Change: S280I

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829
AA Change: S280I

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000114787
AA Change: S280I

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829
AA Change: S280I

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Meta Mutation Damage Score 0.0995 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 88,118,518 (GRCm39) M1L probably benign Het
Adgrf4 C A 17: 42,980,606 (GRCm39) A160S probably damaging Het
Adgrl1 T C 8: 84,656,426 (GRCm39) V243A possibly damaging Het
Adgrl4 G T 3: 151,198,064 (GRCm39) probably null Het
Alg8 A G 7: 97,027,423 (GRCm39) Y97C probably damaging Het
Ankrd12 T A 17: 66,292,754 (GRCm39) D893V probably damaging Het
Anxa6 T A 11: 54,885,791 (GRCm39) T385S probably benign Het
Art4 A T 6: 136,831,365 (GRCm39) C259S probably damaging Het
Ccer2 T C 7: 28,456,561 (GRCm39) S102P possibly damaging Het
Cdhr3 A G 12: 33,132,320 (GRCm39) F101S probably damaging Het
Ctdsp1 G T 1: 74,434,735 (GRCm39) G260W probably damaging Het
Cyp24a1 T C 2: 170,338,277 (GRCm39) Y89C probably damaging Het
Cyp2d34 T C 15: 82,504,901 (GRCm39) D53G probably damaging Het
Dnah7a A C 1: 53,560,326 (GRCm39) I2115S possibly damaging Het
Exoc4 T A 6: 33,895,359 (GRCm39) I792N possibly damaging Het
Gm4353 A G 7: 115,683,006 (GRCm39) F192L probably damaging Het
Hps4 G A 5: 112,525,905 (GRCm39) S642N possibly damaging Het
Ift140 T C 17: 25,317,839 (GRCm39) V1441A probably benign Het
Ighv1-49 A T 12: 115,019,073 (GRCm39) C41S probably damaging Het
Lgalsl A T 11: 20,779,306 (GRCm39) I113N possibly damaging Het
Lrp1b T C 2: 41,401,460 (GRCm39) D398G Het
Lrrc4b A G 7: 44,112,099 (GRCm39) H657R possibly damaging Het
Map2k2 T C 10: 80,955,193 (GRCm39) V228A possibly damaging Het
Mdn1 A G 4: 32,694,612 (GRCm39) I1112V probably benign Het
Mipep T A 14: 61,068,692 (GRCm39) M488K possibly damaging Het
Myo15b A G 11: 115,750,924 (GRCm39) T565A Het
Nfat5 T C 8: 108,095,401 (GRCm39) L1214P probably damaging Het
Nphp3 A G 9: 103,885,328 (GRCm39) T223A probably benign Het
Or10s1 A G 9: 39,986,187 (GRCm39) I199V probably benign Het
Or52s19 A G 7: 103,008,092 (GRCm39) M103T probably damaging Het
Pkn2 G A 3: 142,499,709 (GRCm39) R939W probably damaging Het
Pla2g4c T C 7: 13,059,671 (GRCm39) C3R possibly damaging Het
Plxnd1 A T 6: 115,934,524 (GRCm39) I1803N probably damaging Het
Pygb C A 2: 150,662,781 (GRCm39) H583N possibly damaging Het
Rbm20 A G 19: 53,839,645 (GRCm39) D878G possibly damaging Het
Rdx C A 9: 51,992,468 (GRCm39) Q414K probably benign Het
Scara3 T C 14: 66,169,233 (GRCm39) E128G possibly damaging Het
Sel1l2 T C 2: 140,097,222 (GRCm39) Y361C probably damaging Het
Sfmbt2 T C 2: 10,442,860 (GRCm39) I179T probably benign Het
Sgsm2 C T 11: 74,748,960 (GRCm39) V567M possibly damaging Het
Sirt4 G A 5: 115,618,372 (GRCm39) T234M probably damaging Het
Stab1 T G 14: 30,867,812 (GRCm39) K1653Q probably benign Het
Strn4 T C 7: 16,559,722 (GRCm39) probably benign Het
Tex30 G A 1: 44,126,133 (GRCm39) R199W probably damaging Het
Tjp3 A C 10: 81,110,420 (GRCm39) F731V probably damaging Het
Tmco1 C T 1: 167,136,132 (GRCm39) probably benign Het
Tmco3 A G 8: 13,360,143 (GRCm39) probably null Het
Tmem94 C A 11: 115,683,191 (GRCm39) A658E probably damaging Het
Tnxb T A 17: 34,904,766 (GRCm39) L1177Q probably damaging Het
Trim28 G A 7: 12,763,490 (GRCm39) A544T probably benign Het
Upf2 T A 2: 6,051,845 (GRCm39) V1169D unknown Het
Usp20 C A 2: 30,907,412 (GRCm39) A648D probably damaging Het
Vmn2r108 T G 17: 20,691,330 (GRCm39) N398H probably benign Het
Whamm A T 7: 81,243,655 (GRCm39) S626C probably damaging Het
Zbtb44 A G 9: 30,975,524 (GRCm39) S385G possibly damaging Het
Zfp580 C T 7: 5,056,137 (GRCm39) Q166* probably null Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37,028,462 (GRCm39) missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37,024,940 (GRCm39) missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37,036,341 (GRCm39) missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37,165,454 (GRCm39) missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37,020,954 (GRCm39) missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37,150,257 (GRCm39) missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37,028,567 (GRCm39) missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37,007,016 (GRCm39) nonsense probably null
IGL03125:Stxbp5l APN 16 37,007,083 (GRCm39) missense probably benign 0.02
R0058:Stxbp5l UTSW 16 36,962,736 (GRCm39) missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37,108,670 (GRCm39) missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37,036,440 (GRCm39) splice site probably benign
R0454:Stxbp5l UTSW 16 36,954,646 (GRCm39) missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 36,950,159 (GRCm39) critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37,028,458 (GRCm39) missense probably damaging 1.00
R0606:Stxbp5l UTSW 16 37,024,883 (GRCm39) missense possibly damaging 0.46
R0607:Stxbp5l UTSW 16 36,962,794 (GRCm39) missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37,068,231 (GRCm39) critical splice donor site probably null
R1593:Stxbp5l UTSW 16 36,936,414 (GRCm39) missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37,028,473 (GRCm39) missense probably benign 0.34
R1670:Stxbp5l UTSW 16 37,111,289 (GRCm39) critical splice donor site probably null
R2077:Stxbp5l UTSW 16 37,056,637 (GRCm39) missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37,036,398 (GRCm39) missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 36,936,029 (GRCm39) missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37,028,548 (GRCm39) missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2918:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2935:Stxbp5l UTSW 16 36,954,551 (GRCm39) missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3694:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3695:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R4133:Stxbp5l UTSW 16 37,028,481 (GRCm39) missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37,068,242 (GRCm39) missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37,076,246 (GRCm39) missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37,008,996 (GRCm39) missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 36,954,592 (GRCm39) missense probably benign 0.18
R5105:Stxbp5l UTSW 16 36,962,734 (GRCm39) missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37,007,016 (GRCm39) missense probably benign 0.19
R5358:Stxbp5l UTSW 16 36,994,688 (GRCm39) missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 36,950,213 (GRCm39) missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37,028,459 (GRCm39) missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 36,950,177 (GRCm39) missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37,024,810 (GRCm39) missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37,008,991 (GRCm39) missense possibly damaging 0.94
R7369:Stxbp5l UTSW 16 36,954,703 (GRCm39) missense probably benign 0.12
R7555:Stxbp5l UTSW 16 37,143,965 (GRCm39) missense probably damaging 1.00
R7657:Stxbp5l UTSW 16 37,030,534 (GRCm39) missense probably null 0.21
R8171:Stxbp5l UTSW 16 37,028,416 (GRCm39) missense noncoding transcript
R8338:Stxbp5l UTSW 16 36,994,718 (GRCm39) missense probably damaging 1.00
R8732:Stxbp5l UTSW 16 37,061,809 (GRCm39) missense probably benign
R8833:Stxbp5l UTSW 16 37,024,814 (GRCm39) missense probably benign 0.44
R8883:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8898:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8899:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8906:Stxbp5l UTSW 16 37,028,526 (GRCm39) missense probably damaging 1.00
R8918:Stxbp5l UTSW 16 36,954,892 (GRCm39) missense
R8959:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8961:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8989:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R9027:Stxbp5l UTSW 16 37,165,473 (GRCm39) missense probably damaging 1.00
R9044:Stxbp5l UTSW 16 37,024,930 (GRCm39) missense possibly damaging 0.77
R9284:Stxbp5l UTSW 16 37,028,442 (GRCm39) nonsense probably null
R9351:Stxbp5l UTSW 16 36,936,047 (GRCm39) missense probably damaging 1.00
R9425:Stxbp5l UTSW 16 36,994,706 (GRCm39) missense possibly damaging 0.83
R9545:Stxbp5l UTSW 16 37,028,625 (GRCm39) critical splice acceptor site probably null
R9567:Stxbp5l UTSW 16 37,061,734 (GRCm39) missense probably benign 0.37
R9616:Stxbp5l UTSW 16 37,036,314 (GRCm39) missense probably damaging 1.00
R9781:Stxbp5l UTSW 16 37,165,485 (GRCm39) missense probably benign 0.38
Z1088:Stxbp5l UTSW 16 37,024,851 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCTAGAATAAGCTCTCTGTAGGAG -3'
(R):5'- CAAAGAAGCCTAGTCTGTGTCAG -3'

Sequencing Primer
(F):5'- CTCTGTAGGAGAGCCATTGGATATC -3'
(R):5'- GTGATATATCTACTTTCCCCTG -3'
Posted On 2022-02-07