Incidental Mutation 'R9226:Ift140'
ID 699884
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Name intraflagellar transport 140
Synonyms Tce5, Wdtc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9226 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 25016091-25099495 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25098865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1441 (V1441A)
Ref Sequence ENSEMBL: ENSMUSP00000024983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000024987] [ENSMUST00000115181]
AlphaFold E9PY46
Predicted Effect probably benign
Transcript: ENSMUST00000024983
AA Change: V1441A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: V1441A

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000024987
SMART Domains Protein: ENSMUSP00000024987
Gene: ENSMUSG00000024170

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115181
SMART Domains Protein: ENSMUSP00000110835
Gene: ENSMUSG00000024170

DomainStartEndE-ValueType
Pfam:Telomere_reg-2 513 621 3.8e-38 PFAM
low complexity region 771 782 N/A INTRINSIC
low complexity region 816 837 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A T 5: 87,970,659 M1L probably benign Het
Adgrf4 C A 17: 42,669,715 A160S probably damaging Het
Adgrl1 T C 8: 83,929,797 V243A possibly damaging Het
Adgrl4 G T 3: 151,492,427 probably null Het
Alg8 A G 7: 97,378,216 Y97C probably damaging Het
Ankrd12 T A 17: 65,985,759 D893V probably damaging Het
Anxa6 T A 11: 54,994,965 T385S probably benign Het
Art4 A T 6: 136,854,367 C259S probably damaging Het
Ccer2 T C 7: 28,757,136 S102P possibly damaging Het
Cdhr3 A G 12: 33,082,321 F101S probably damaging Het
Ctdsp1 G T 1: 74,395,576 G260W probably damaging Het
Cyp24a1 T C 2: 170,496,357 Y89C probably damaging Het
Cyp2d34 T C 15: 82,620,700 D53G probably damaging Het
Dnah7a A C 1: 53,521,167 I2115S possibly damaging Het
Exoc4 T A 6: 33,918,424 I792N possibly damaging Het
Gm4353 A G 7: 116,083,771 F192L probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Ighv1-49 A T 12: 115,055,453 C41S probably damaging Het
Lgalsl A T 11: 20,829,306 I113N possibly damaging Het
Lrp1b T C 2: 41,511,448 D398G Het
Lrrc4b A G 7: 44,462,675 H657R possibly damaging Het
Map2k2 T C 10: 81,119,359 V228A possibly damaging Het
Mdn1 A G 4: 32,694,612 I1112V probably benign Het
Mipep T A 14: 60,831,243 M488K possibly damaging Het
Myo15b A G 11: 115,860,098 T565A Het
Nfat5 T C 8: 107,368,769 L1214P probably damaging Het
Nphp3 A G 9: 104,008,129 T223A probably benign Het
Olfr601 A G 7: 103,358,885 M103T probably damaging Het
Olfr982 A G 9: 40,074,891 I199V probably benign Het
Pkn2 G A 3: 142,793,948 R939W probably damaging Het
Pla2g4c T C 7: 13,325,746 C3R possibly damaging Het
Plxnd1 A T 6: 115,957,563 I1803N probably damaging Het
Pygb C A 2: 150,820,861 H583N possibly damaging Het
Rbm20 A G 19: 53,851,214 D878G possibly damaging Het
Rdx C A 9: 52,081,168 Q414K probably benign Het
Scara3 T C 14: 65,931,784 E128G possibly damaging Het
Sel1l2 T C 2: 140,255,302 Y361C probably damaging Het
Sfmbt2 T C 2: 10,438,049 I179T probably benign Het
Sgsm2 C T 11: 74,858,134 V567M possibly damaging Het
Sirt4 G A 5: 115,480,313 T234M probably damaging Het
Stab1 T G 14: 31,145,855 K1653Q probably benign Het
Strn4 T C 7: 16,825,797 probably benign Het
Stxbp5l C A 16: 37,255,844 S280I probably damaging Het
Tex30 G A 1: 44,086,973 R199W probably damaging Het
Tjp3 A C 10: 81,274,586 F731V probably damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmco3 A G 8: 13,310,143 probably null Het
Tmem94 C A 11: 115,792,365 A658E probably damaging Het
Tnxb T A 17: 34,685,792 L1177Q probably damaging Het
Trim28 G A 7: 13,029,563 A544T probably benign Het
Upf2 T A 2: 6,047,034 V1169D unknown Het
Usp20 C A 2: 31,017,400 A648D probably damaging Het
Vmn2r108 T G 17: 20,471,068 N398H probably benign Het
Whamm A T 7: 81,593,907 S626C probably damaging Het
Zbtb44 A G 9: 31,064,228 S385G possibly damaging Het
Zfp580 C T 7: 5,053,138 Q166* probably null Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25055644 missense probably damaging 1.00
IGL00966:Ift140 APN 17 25018802 missense probably damaging 1.00
IGL01082:Ift140 APN 17 25048455 missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25094702 missense probably benign 0.02
IGL01816:Ift140 APN 17 25087025 splice site probably null
IGL01994:Ift140 APN 17 25048443 missense probably damaging 1.00
IGL02102:Ift140 APN 17 25033130 missense probably benign 0.03
IGL02207:Ift140 APN 17 25055598 missense probably benign
IGL02493:Ift140 APN 17 25087924 nonsense probably null
IGL02735:Ift140 APN 17 25034035 splice site probably benign
IGL02902:Ift140 APN 17 25090762 missense probably damaging 1.00
IGL03037:Ift140 APN 17 25092394 missense probably benign 0.02
IGL03122:Ift140 APN 17 25086910 missense probably damaging 1.00
IGL03206:Ift140 APN 17 25092826 missense probably damaging 0.98
IGL03271:Ift140 APN 17 25087906 missense probably damaging 1.00
IGL03358:Ift140 APN 17 25087984 missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25086860 missense probably damaging 0.98
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0100:Ift140 UTSW 17 25090954 nonsense probably null
R0197:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0238:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0239:Ift140 UTSW 17 25045523 nonsense probably null
R0355:Ift140 UTSW 17 25048435 nonsense probably null
R0399:Ift140 UTSW 17 25050340 missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25051760 splice site probably null
R0610:Ift140 UTSW 17 25035803 missense probably benign 0.06
R0701:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0883:Ift140 UTSW 17 25090933 missense probably benign 0.09
R0900:Ift140 UTSW 17 25035812 missense probably benign 0.22
R1167:Ift140 UTSW 17 25035745 missense probably benign 0.01
R1295:Ift140 UTSW 17 25088933 critical splice donor site probably null
R1588:Ift140 UTSW 17 25087985 missense probably damaging 1.00
R1619:Ift140 UTSW 17 25088865 missense probably damaging 1.00
R1637:Ift140 UTSW 17 25025634 missense probably benign 0.40
R1854:Ift140 UTSW 17 25035839 missense probably benign 0.05
R2397:Ift140 UTSW 17 25020736 missense probably damaging 1.00
R2510:Ift140 UTSW 17 25036308 missense probably benign 0.02
R2918:Ift140 UTSW 17 25035831 missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25036308 missense probably benign 0.02
R3878:Ift140 UTSW 17 25028944 missense probably benign 0.25
R4559:Ift140 UTSW 17 25090767 missense probably damaging 0.97
R4670:Ift140 UTSW 17 25098961 unclassified probably benign
R4711:Ift140 UTSW 17 25094717 splice site probably null
R4934:Ift140 UTSW 17 25048488 missense probably benign
R4949:Ift140 UTSW 17 25094665 missense probably benign 0.06
R4982:Ift140 UTSW 17 25036994 missense probably damaging 0.99
R5099:Ift140 UTSW 17 25090700 missense probably damaging 1.00
R5223:Ift140 UTSW 17 25035812 missense probably benign 0.22
R5268:Ift140 UTSW 17 25020627 missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25033085 missense probably damaging 0.96
R5480:Ift140 UTSW 17 25020576 missense probably damaging 1.00
R5655:Ift140 UTSW 17 25045064 missense probably damaging 1.00
R5756:Ift140 UTSW 17 25028813 missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25089540 missense probably damaging 1.00
R5894:Ift140 UTSW 17 25033919 missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25092371 missense probably benign 0.02
R5966:Ift140 UTSW 17 25094761 nonsense probably null
R6000:Ift140 UTSW 17 25036960 missense probably benign 0.00
R6046:Ift140 UTSW 17 25055589 missense probably benign 0.00
R6050:Ift140 UTSW 17 25091005 missense probably damaging 1.00
R6103:Ift140 UTSW 17 25093126 missense probably damaging 1.00
R6239:Ift140 UTSW 17 25028972 missense probably benign 0.26
R6287:Ift140 UTSW 17 25050434 missense probably benign
R6539:Ift140 UTSW 17 25094669 missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25032173 missense probably damaging 0.96
R6723:Ift140 UTSW 17 25033116 missense probably benign 0.08
R6749:Ift140 UTSW 17 25098916 missense probably damaging 0.99
R6892:Ift140 UTSW 17 25020546 missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25055725 missense probably damaging 1.00
R7235:Ift140 UTSW 17 25020645 missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25037036 missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25033115 missense probably benign 0.02
R7560:Ift140 UTSW 17 25092341 missense probably benign 0.28
R7660:Ift140 UTSW 17 25051824 missense probably damaging 1.00
R8105:Ift140 UTSW 17 25036975 missense probably benign 0.01
R8415:Ift140 UTSW 17 25092915 missense probably damaging 0.99
R8437:Ift140 UTSW 17 25094677 missense probably damaging 0.99
R8747:Ift140 UTSW 17 25035835 missense probably benign
R8932:Ift140 UTSW 17 25086888 missense probably benign 0.03
R9347:Ift140 UTSW 17 25094779 missense probably benign 0.00
R9451:Ift140 UTSW 17 25033951 missense probably benign 0.33
R9456:Ift140 UTSW 17 25035784 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTCCATGCGACCTACAGAAG -3'
(R):5'- CACCGCTCTTGCTTACAATG -3'

Sequencing Primer
(F):5'- CTACAGAAGTAACTGGTGGTCACATC -3'
(R):5'- CAGCTGCCTTTCTGATGA -3'
Posted On 2022-02-07