Incidental Mutation 'R9227:Atp6v0d2'
ID 699911
Institutional Source Beutler Lab
Gene Symbol Atp6v0d2
Ensembl Gene ENSMUSG00000028238
Gene Name ATPase, H+ transporting, lysosomal V0 subunit D2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9227 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 19876841-19922605 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 19878374 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 300 (M300L)
Ref Sequence ENSEMBL: ENSMUSP00000029900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029900]
AlphaFold Q80SY3
Predicted Effect probably benign
Transcript: ENSMUST00000029900
AA Change: M300L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029900
Gene: ENSMUSG00000028238
AA Change: M300L

DomainStartEndE-ValueType
Pfam:vATP-synt_AC39 16 346 6.2e-113 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display osteopetrosis and impaired osteoclast maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A T 10: 77,321,792 F274I probably damaging Het
Adprhl1 C T 8: 13,221,974 V1595I probably benign Het
Anxa6 A G 11: 55,007,868 V160A probably benign Het
Appl1 T C 14: 26,923,735 E706G unknown Het
Arhgap21 T C 2: 20,855,658 T1313A possibly damaging Het
Armc2 T C 10: 41,947,939 Y511C probably damaging Het
Atp1a1 A T 3: 101,592,434 C111S probably damaging Het
BC027072 A G 17: 71,750,222 L820P probably damaging Het
C1ra T C 6: 124,516,780 C164R probably damaging Het
Cacna1h T C 17: 25,380,882 Y1659C probably damaging Het
Catsperb T C 12: 101,549,794 I563T probably benign Het
Cd180 TA TAA 13: 102,705,006 probably null Het
Cd55b A T 1: 130,422,882 L26* probably null Het
Cdc42bpa A G 1: 180,106,073 N759S probably benign Het
Cenpj C T 14: 56,564,719 E130K possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chd7 C T 4: 8,805,272 S777L probably benign Het
Chrm3 C A 13: 9,878,443 V186L probably benign Het
Clrn2 A G 5: 45,463,941 T226A probably damaging Het
Col3a1 C T 1: 45,343,978 P1071S unknown Het
Dytn A T 1: 63,647,452 V353D probably benign Het
Egfem1 G A 3: 29,357,168 E155K probably benign Het
Eif3m A T 2: 105,001,360 M285K probably damaging Het
Fam135b T C 15: 71,464,007 K446R probably benign Het
Fam186a T C 15: 99,955,503 T119A unknown Het
Frmd4a T C 2: 4,608,033 S1025P possibly damaging Het
Fubp3 A G 2: 31,612,552 H449R probably benign Het
Fyco1 A T 9: 123,819,146 I1241N probably damaging Het
Gabpb2 A T 3: 95,204,687 M77K probably damaging Het
Gfpt1 T A 6: 87,050,924 I4K probably damaging Het
Gif G A 19: 11,760,384 W386* probably null Het
Glis1 T C 4: 107,568,130 S313P probably benign Het
Gm3376 T G Y: 3,774,819 D5E probably damaging Het
Golga4 T A 9: 118,556,873 M1021K possibly damaging Het
Grid2ip G A 5: 143,373,439 R270Q probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Ifit1 A G 19: 34,647,836 E124G possibly damaging Het
Ifna14 T C 4: 88,571,515 D95G probably benign Het
Ilkap A C 1: 91,387,215 I142S probably benign Het
Inpp5e C T 2: 26,398,604 R588H probably damaging Het
Kif1b A C 4: 149,237,900 M854R probably damaging Het
Lcn6 A T 2: 25,680,095 K91M probably damaging Het
Lpin1 A T 12: 16,538,482 S902R unknown Het
Lrig1 C A 6: 94,630,132 C160F probably damaging Het
Mapk13 T C 17: 28,775,558 I141T probably damaging Het
Mapkapk3 A G 9: 107,260,155 L175P probably damaging Het
Micall2 A G 5: 139,716,072 V472A unknown Het
Mmp15 T C 8: 95,366,331 F113L probably benign Het
Msh2 T G 17: 87,719,289 S738A probably benign Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myo1f T C 17: 33,576,450 V53A probably damaging Het
Ncf1 A T 5: 134,221,864 N367K probably benign Het
Nim1k C A 13: 119,712,582 V259F probably damaging Het
Nme8 T G 13: 19,690,214 I139L probably benign Het
Odam T C 5: 87,886,598 F46L probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr8 G A 10: 78,956,095 D297N possibly damaging Het
Pcdha9 A G 18: 36,998,901 E341G probably damaging Het
Pmepa1 T C 2: 173,276,169 T6A probably benign Het
Poglut1 A T 16: 38,534,806 D219E possibly damaging Het
Racgap1 A G 15: 99,636,197 S145P possibly damaging Het
Rasgef1a C T 6: 118,089,149 T441I possibly damaging Het
Rbm6 T C 9: 107,787,299 T844A probably benign Het
Rell1 T C 5: 63,939,762 probably benign Het
Ripk3 A G 14: 55,785,846 F134S probably benign Het
Rnf169 T C 7: 99,925,492 D632G possibly damaging Het
Sclt1 A T 3: 41,711,196 W146R probably benign Het
Setd5 T C 6: 113,121,794 F796S possibly damaging Het
Slc24a5 G T 2: 125,080,648 G110V probably damaging Het
Slc30a10 T A 1: 185,455,194 M44K probably damaging Het
Slc38a10 T A 11: 120,105,955 D772V probably benign Het
Thy1 C T 9: 44,046,707 T44I probably damaging Het
Tinagl1 G T 4: 130,167,478 S324Y probably benign Het
Tll2 T A 19: 41,104,997 Y477F probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmco6 T C 18: 36,741,666 L402P probably damaging Het
Tnrc18 G T 5: 142,787,637 A479D Het
Uba7 T C 9: 107,975,802 V12A possibly damaging Het
Usp5 T C 6: 124,818,636 D598G probably damaging Het
Vmn1r158 C T 7: 22,790,044 V247I probably benign Het
Vpreb2 A G 16: 17,980,937 N96D probably damaging Het
Zcchc17 A T 4: 130,337,135 M87K probably damaging Het
Other mutations in Atp6v0d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Atp6v0d2 APN 4 19881436 missense probably damaging 1.00
IGL01759:Atp6v0d2 APN 4 19878335 missense probably damaging 0.98
IGL02006:Atp6v0d2 APN 4 19878325 missense probably damaging 1.00
IGL02515:Atp6v0d2 APN 4 19880063 missense possibly damaging 0.63
IGL03100:Atp6v0d2 APN 4 19910586 critical splice donor site probably null
IGL02796:Atp6v0d2 UTSW 4 19887324 missense probably damaging 1.00
R0083:Atp6v0d2 UTSW 4 19880001 splice site probably benign
R0133:Atp6v0d2 UTSW 4 19910578 splice site probably benign
R0371:Atp6v0d2 UTSW 4 19880033 missense possibly damaging 0.92
R0845:Atp6v0d2 UTSW 4 19880055 missense probably benign 0.02
R1279:Atp6v0d2 UTSW 4 19878298 missense probably benign 0.02
R1541:Atp6v0d2 UTSW 4 19910645 missense probably damaging 1.00
R1802:Atp6v0d2 UTSW 4 19922366 critical splice donor site probably null
R3417:Atp6v0d2 UTSW 4 19888829 unclassified probably benign
R3833:Atp6v0d2 UTSW 4 19922395 missense probably damaging 1.00
R3884:Atp6v0d2 UTSW 4 19910677 missense probably damaging 1.00
R5158:Atp6v0d2 UTSW 4 19878292 missense probably damaging 1.00
R6284:Atp6v0d2 UTSW 4 19922605 splice site probably null
R7290:Atp6v0d2 UTSW 4 19880060 missense probably benign 0.44
R7341:Atp6v0d2 UTSW 4 19887330 missense possibly damaging 0.46
R7832:Atp6v0d2 UTSW 4 19922400 missense probably benign 0.18
R8231:Atp6v0d2 UTSW 4 19881451 missense probably damaging 1.00
R8757:Atp6v0d2 UTSW 4 19910649 missense probably benign
R8759:Atp6v0d2 UTSW 4 19910649 missense probably benign
R8811:Atp6v0d2 UTSW 4 19922397 missense probably benign 0.05
R9334:Atp6v0d2 UTSW 4 19890695 missense probably damaging 1.00
R9378:Atp6v0d2 UTSW 4 19922377 missense probably benign 0.02
R9716:Atp6v0d2 UTSW 4 19890834 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTAGATAATGTGACACAATCCCC -3'
(R):5'- TGCTGAGTTGCCTCTGATCC -3'

Sequencing Primer
(F):5'- GGCAACATGTATGATCTTCTGTACAC -3'
(R):5'- GATCCCACTATTGGTCCAACTGG -3'
Posted On 2022-02-07