Incidental Mutation 'R9227:Kif1b'
ID 699916
Institutional Source Beutler Lab
Gene Symbol Kif1b
Ensembl Gene ENSMUSG00000063077
Gene Name kinesin family member 1B
Synonyms Kif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9227 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 149176319-149307693 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 149237900 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 854 (M854R)
Ref Sequence ENSEMBL: ENSMUSP00000030806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030806] [ENSMUST00000055647] [ENSMUST00000060537]
AlphaFold Q60575
Predicted Effect probably damaging
Transcript: ENSMUST00000030806
AA Change: M854R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030806
Gene: ENSMUSG00000063077
AA Change: M854R

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 660 N/A INTRINSIC
coiled coil region 814 858 N/A INTRINSIC
low complexity region 889 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055647
SMART Domains Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 685 N/A INTRINSIC
Pfam:KIF1B 799 846 9.7e-13 PFAM
internal_repeat_1 901 933 7.01e-7 PROSPERO
low complexity region 1165 1179 N/A INTRINSIC
Pfam:DUF3694 1220 1368 1.1e-46 PFAM
low complexity region 1444 1461 N/A INTRINSIC
low complexity region 1479 1507 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
PH 1656 1755 1.02e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060537
SMART Domains Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077

DomainStartEndE-ValueType
KISc 3 362 7.61e-175 SMART
low complexity region 390 400 N/A INTRINSIC
low complexity region 432 450 N/A INTRINSIC
FHA 555 612 1.61e-4 SMART
coiled coil region 672 731 N/A INTRINSIC
Pfam:KIF1B 845 892 7.1e-15 PFAM
internal_repeat_1 947 979 4.76e-7 PROSPERO
low complexity region 1211 1225 N/A INTRINSIC
Pfam:DUF3694 1266 1413 1.1e-40 PFAM
low complexity region 1490 1507 N/A INTRINSIC
low complexity region 1525 1553 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
PH 1702 1801 1.02e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A T 10: 77,321,792 F274I probably damaging Het
Adprhl1 C T 8: 13,221,974 V1595I probably benign Het
Anxa6 A G 11: 55,007,868 V160A probably benign Het
Appl1 T C 14: 26,923,735 E706G unknown Het
Arhgap21 T C 2: 20,855,658 T1313A possibly damaging Het
Armc2 T C 10: 41,947,939 Y511C probably damaging Het
Atp1a1 A T 3: 101,592,434 C111S probably damaging Het
Atp6v0d2 T A 4: 19,878,374 M300L probably benign Het
BC027072 A G 17: 71,750,222 L820P probably damaging Het
C1ra T C 6: 124,516,780 C164R probably damaging Het
Cacna1h T C 17: 25,380,882 Y1659C probably damaging Het
Catsperb T C 12: 101,549,794 I563T probably benign Het
Cd180 TA TAA 13: 102,705,006 probably null Het
Cd55b A T 1: 130,422,882 L26* probably null Het
Cdc42bpa A G 1: 180,106,073 N759S probably benign Het
Cenpj C T 14: 56,564,719 E130K possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chd7 C T 4: 8,805,272 S777L probably benign Het
Chrm3 C A 13: 9,878,443 V186L probably benign Het
Clrn2 A G 5: 45,463,941 T226A probably damaging Het
Col3a1 C T 1: 45,343,978 P1071S unknown Het
Dytn A T 1: 63,647,452 V353D probably benign Het
Egfem1 G A 3: 29,357,168 E155K probably benign Het
Eif3m A T 2: 105,001,360 M285K probably damaging Het
Fam135b T C 15: 71,464,007 K446R probably benign Het
Fam186a T C 15: 99,955,503 T119A unknown Het
Frmd4a T C 2: 4,608,033 S1025P possibly damaging Het
Fubp3 A G 2: 31,612,552 H449R probably benign Het
Fyco1 A T 9: 123,819,146 I1241N probably damaging Het
Gabpb2 A T 3: 95,204,687 M77K probably damaging Het
Gfpt1 T A 6: 87,050,924 I4K probably damaging Het
Gif G A 19: 11,760,384 W386* probably null Het
Glis1 T C 4: 107,568,130 S313P probably benign Het
Gm3376 T G Y: 3,774,819 D5E probably damaging Het
Golga4 T A 9: 118,556,873 M1021K possibly damaging Het
Grid2ip G A 5: 143,373,439 R270Q probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Ifit1 A G 19: 34,647,836 E124G possibly damaging Het
Ifna14 T C 4: 88,571,515 D95G probably benign Het
Ilkap A C 1: 91,387,215 I142S probably benign Het
Inpp5e C T 2: 26,398,604 R588H probably damaging Het
Lcn6 A T 2: 25,680,095 K91M probably damaging Het
Lpin1 A T 12: 16,538,482 S902R unknown Het
Lrig1 C A 6: 94,630,132 C160F probably damaging Het
Mapk13 T C 17: 28,775,558 I141T probably damaging Het
Mapkapk3 A G 9: 107,260,155 L175P probably damaging Het
Micall2 A G 5: 139,716,072 V472A unknown Het
Mmp15 T C 8: 95,366,331 F113L probably benign Het
Msh2 T G 17: 87,719,289 S738A probably benign Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myo1f T C 17: 33,576,450 V53A probably damaging Het
Ncf1 A T 5: 134,221,864 N367K probably benign Het
Nim1k C A 13: 119,712,582 V259F probably damaging Het
Nme8 T G 13: 19,690,214 I139L probably benign Het
Odam T C 5: 87,886,598 F46L probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr8 G A 10: 78,956,095 D297N possibly damaging Het
Pcdha9 A G 18: 36,998,901 E341G probably damaging Het
Pmepa1 T C 2: 173,276,169 T6A probably benign Het
Poglut1 A T 16: 38,534,806 D219E possibly damaging Het
Racgap1 A G 15: 99,636,197 S145P possibly damaging Het
Rasgef1a C T 6: 118,089,149 T441I possibly damaging Het
Rbm6 T C 9: 107,787,299 T844A probably benign Het
Rell1 T C 5: 63,939,762 probably benign Het
Ripk3 A G 14: 55,785,846 F134S probably benign Het
Rnf169 T C 7: 99,925,492 D632G possibly damaging Het
Sclt1 A T 3: 41,711,196 W146R probably benign Het
Setd5 T C 6: 113,121,794 F796S possibly damaging Het
Slc24a5 G T 2: 125,080,648 G110V probably damaging Het
Slc30a10 T A 1: 185,455,194 M44K probably damaging Het
Slc38a10 T A 11: 120,105,955 D772V probably benign Het
Thy1 C T 9: 44,046,707 T44I probably damaging Het
Tinagl1 G T 4: 130,167,478 S324Y probably benign Het
Tll2 T A 19: 41,104,997 Y477F probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmco6 T C 18: 36,741,666 L402P probably damaging Het
Tnrc18 G T 5: 142,787,637 A479D Het
Uba7 T C 9: 107,975,802 V12A possibly damaging Het
Usp5 T C 6: 124,818,636 D598G probably damaging Het
Vmn1r158 C T 7: 22,790,044 V247I probably benign Het
Vpreb2 A G 16: 17,980,937 N96D probably damaging Het
Zcchc17 A T 4: 130,337,135 M87K probably damaging Het
Other mutations in Kif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Kif1b APN 4 149220602 missense probably damaging 1.00
IGL01943:Kif1b APN 4 149214905 critical splice donor site probably null
IGL02240:Kif1b APN 4 149246414 missense probably damaging 1.00
IGL02414:Kif1b APN 4 149199314 missense probably damaging 0.96
IGL02490:Kif1b APN 4 149204208 missense probably benign
IGL02501:Kif1b APN 4 149214976 missense probably damaging 1.00
IGL02833:Kif1b APN 4 149246364 missense probably damaging 1.00
IGL02852:Kif1b APN 4 149291328 missense probably damaging 1.00
IGL02900:Kif1b APN 4 149180809 missense possibly damaging 0.81
IGL03287:Kif1b APN 4 149214981 missense possibly damaging 0.67
IGL03412:Kif1b APN 4 149274939 missense probably benign 0.00
PIT4305001:Kif1b UTSW 4 149220792 critical splice acceptor site probably null
R0005:Kif1b UTSW 4 149181927 missense probably damaging 1.00
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0129:Kif1b UTSW 4 149261201 missense probably benign
R0180:Kif1b UTSW 4 149213659 missense probably damaging 1.00
R0288:Kif1b UTSW 4 149199338 missense probably damaging 1.00
R0360:Kif1b UTSW 4 149262729 missense probably damaging 1.00
R0383:Kif1b UTSW 4 149202512 missense probably damaging 1.00
R0398:Kif1b UTSW 4 149204231 missense possibly damaging 0.89
R0403:Kif1b UTSW 4 149181967 nonsense probably null
R0445:Kif1b UTSW 4 149188009 missense probably benign 0.01
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1681:Kif1b UTSW 4 149195501 critical splice acceptor site probably null
R1728:Kif1b UTSW 4 149187722 missense probably damaging 0.99
R1840:Kif1b UTSW 4 149188132 missense probably damaging 1.00
R1874:Kif1b UTSW 4 149187632 missense probably benign
R1915:Kif1b UTSW 4 149267216 missense probably damaging 1.00
R2106:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2124:Kif1b UTSW 4 149222296 missense probably benign 0.08
R2126:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2127:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2128:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2129:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2146:Kif1b UTSW 4 149184309 missense probably damaging 0.99
R2255:Kif1b UTSW 4 149274997 missense probably damaging 1.00
R2392:Kif1b UTSW 4 149220620 missense possibly damaging 0.93
R2883:Kif1b UTSW 4 149237648 missense possibly damaging 0.78
R2981:Kif1b UTSW 4 149220541 critical splice donor site probably null
R3038:Kif1b UTSW 4 149213333 missense probably benign 0.02
R3616:Kif1b UTSW 4 149262283 splice site probably benign
R3935:Kif1b UTSW 4 149237160 missense probably benign 0.00
R4347:Kif1b UTSW 4 149247234 missense probably damaging 1.00
R4423:Kif1b UTSW 4 149214105 missense probably damaging 0.99
R4637:Kif1b UTSW 4 149199311 missense probably damaging 0.97
R4745:Kif1b UTSW 4 149237882 nonsense probably null
R4807:Kif1b UTSW 4 149247921 intron probably benign
R5618:Kif1b UTSW 4 149269889 missense possibly damaging 0.94
R5644:Kif1b UTSW 4 149238482 missense probably damaging 0.96
R5683:Kif1b UTSW 4 149222261 missense probably damaging 1.00
R5696:Kif1b UTSW 4 149273849 splice site probably null
R6022:Kif1b UTSW 4 149198532 missense probably benign 0.01
R6048:Kif1b UTSW 4 149263629 missense probably damaging 1.00
R6137:Kif1b UTSW 4 149238426 missense possibly damaging 0.47
R6139:Kif1b UTSW 4 149237532 missense possibly damaging 0.88
R6171:Kif1b UTSW 4 149258048 missense probably damaging 1.00
R6250:Kif1b UTSW 4 149213643 missense probably benign 0.00
R6423:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6424:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6425:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6443:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6460:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6462:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6463:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6469:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6470:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6471:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6472:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6504:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6536:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6537:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6668:Kif1b UTSW 4 149213407 missense probably benign 0.09
R6698:Kif1b UTSW 4 149274956 missense probably damaging 0.99
R7065:Kif1b UTSW 4 149202525 missense possibly damaging 0.46
R7222:Kif1b UTSW 4 149225157 missense probably damaging 1.00
R7342:Kif1b UTSW 4 149214090 missense possibly damaging 0.94
R7720:Kif1b UTSW 4 149182355 missense probably benign 0.01
R7744:Kif1b UTSW 4 149237075 missense possibly damaging 0.83
R7797:Kif1b UTSW 4 149237387 missense probably benign
R7829:Kif1b UTSW 4 149220990 splice site probably null
R7869:Kif1b UTSW 4 149184376 missense probably benign 0.01
R7878:Kif1b UTSW 4 149214997 missense probably damaging 0.98
R7980:Kif1b UTSW 4 149269921 missense probably damaging 1.00
R8047:Kif1b UTSW 4 149214922 missense probably damaging 1.00
R8237:Kif1b UTSW 4 149191185 missense probably benign 0.10
R8243:Kif1b UTSW 4 149204267 missense probably benign
R8252:Kif1b UTSW 4 149273805 missense probably damaging 1.00
R8342:Kif1b UTSW 4 149222348 missense probably damaging 0.96
R8460:Kif1b UTSW 4 149187620 missense possibly damaging 0.93
R8462:Kif1b UTSW 4 149182340 missense probably benign 0.05
R8496:Kif1b UTSW 4 149192611 nonsense probably null
R8687:Kif1b UTSW 4 149261163 nonsense probably null
R8694:Kif1b UTSW 4 149220567 missense probably damaging 0.98
R8842:Kif1b UTSW 4 149253739 missense probably damaging 0.98
R8883:Kif1b UTSW 4 149276885 missense probably benign
R8971:Kif1b UTSW 4 149247816 missense probably damaging 1.00
R8994:Kif1b UTSW 4 149195482 missense
R9002:Kif1b UTSW 4 149191255 missense probably damaging 0.96
R9231:Kif1b UTSW 4 149191195 missense possibly damaging 0.94
R9450:Kif1b UTSW 4 149238010 missense probably benign 0.01
R9478:Kif1b UTSW 4 149261159 critical splice donor site probably null
R9571:Kif1b UTSW 4 149220641 missense probably damaging 1.00
R9644:Kif1b UTSW 4 149291379 missense probably damaging 1.00
RF008:Kif1b UTSW 4 149251738 splice site probably null
X0009:Kif1b UTSW 4 149247264 missense probably damaging 1.00
X0062:Kif1b UTSW 4 149275005 missense probably damaging 1.00
Z1176:Kif1b UTSW 4 149266298 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAAGCTGGATCCCCGTTCATC -3'
(R):5'- AATGAGCGAGACTCTTGGAG -3'

Sequencing Primer
(F):5'- TTCATCAGCTGGGAAACGC -3'
(R):5'- CAGGGATGTCTGGGACACTG -3'
Posted On 2022-02-07