Incidental Mutation 'R9227:Tnrc18'
ID 699922
Institutional Source Beutler Lab
Gene Symbol Tnrc18
Ensembl Gene ENSMUSG00000039477
Gene Name trinucleotide repeat containing 18
Synonyms Zfp469, EG381742
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock # R9227 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 142724661-142817662 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 142787637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 479 (A479D)
Ref Sequence ENSEMBL: ENSMUSP00000114769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151477] [ENSMUST00000152247]
AlphaFold no structure available at present
Predicted Effect
SMART Domains Protein: ENSMUSP00000114769
Gene: ENSMUSG00000039477
AA Change: A479D

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
coiled coil region 843 876 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 951 970 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
low complexity region 1269 1289 N/A INTRINSIC
coiled coil region 1411 1443 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1581 1593 N/A INTRINSIC
low complexity region 1608 1619 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152247
AA Change: A296D
SMART Domains Protein: ENSMUSP00000117651
Gene: ENSMUSG00000039477
AA Change: A296D

DomainStartEndE-ValueType
low complexity region 57 104 N/A INTRINSIC
low complexity region 186 207 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 733 747 N/A INTRINSIC
low complexity region 768 787 N/A INTRINSIC
low complexity region 797 810 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
low complexity region 1086 1106 N/A INTRINSIC
coiled coil region 1228 1260 N/A INTRINSIC
low complexity region 1294 1310 N/A INTRINSIC
low complexity region 1398 1410 N/A INTRINSIC
low complexity region 1425 1436 N/A INTRINSIC
coiled coil region 1570 1592 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1641 1653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A T 10: 77,321,792 F274I probably damaging Het
Adprhl1 C T 8: 13,221,974 V1595I probably benign Het
Anxa6 A G 11: 55,007,868 V160A probably benign Het
Appl1 T C 14: 26,923,735 E706G unknown Het
Arhgap21 T C 2: 20,855,658 T1313A possibly damaging Het
Armc2 T C 10: 41,947,939 Y511C probably damaging Het
Atp1a1 A T 3: 101,592,434 C111S probably damaging Het
Atp6v0d2 T A 4: 19,878,374 M300L probably benign Het
BC027072 A G 17: 71,750,222 L820P probably damaging Het
C1ra T C 6: 124,516,780 C164R probably damaging Het
Cacna1h T C 17: 25,380,882 Y1659C probably damaging Het
Catsperb T C 12: 101,549,794 I563T probably benign Het
Cd180 TA TAA 13: 102,705,006 probably null Het
Cd55b A T 1: 130,422,882 L26* probably null Het
Cdc42bpa A G 1: 180,106,073 N759S probably benign Het
Cenpj C T 14: 56,564,719 E130K possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chd7 C T 4: 8,805,272 S777L probably benign Het
Chrm3 C A 13: 9,878,443 V186L probably benign Het
Clrn2 A G 5: 45,463,941 T226A probably damaging Het
Col3a1 C T 1: 45,343,978 P1071S unknown Het
Dytn A T 1: 63,647,452 V353D probably benign Het
Egfem1 G A 3: 29,357,168 E155K probably benign Het
Eif3m A T 2: 105,001,360 M285K probably damaging Het
Fam135b T C 15: 71,464,007 K446R probably benign Het
Fam186a T C 15: 99,955,503 T119A unknown Het
Frmd4a T C 2: 4,608,033 S1025P possibly damaging Het
Fubp3 A G 2: 31,612,552 H449R probably benign Het
Fyco1 A T 9: 123,819,146 I1241N probably damaging Het
Gabpb2 A T 3: 95,204,687 M77K probably damaging Het
Gfpt1 T A 6: 87,050,924 I4K probably damaging Het
Gif G A 19: 11,760,384 W386* probably null Het
Glis1 T C 4: 107,568,130 S313P probably benign Het
Gm3376 T G Y: 3,774,819 D5E probably damaging Het
Golga4 T A 9: 118,556,873 M1021K possibly damaging Het
Grid2ip G A 5: 143,373,439 R270Q probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Ifit1 A G 19: 34,647,836 E124G possibly damaging Het
Ifna14 T C 4: 88,571,515 D95G probably benign Het
Ilkap A C 1: 91,387,215 I142S probably benign Het
Inpp5e C T 2: 26,398,604 R588H probably damaging Het
Kif1b A C 4: 149,237,900 M854R probably damaging Het
Lcn6 A T 2: 25,680,095 K91M probably damaging Het
Lpin1 A T 12: 16,538,482 S902R unknown Het
Lrig1 C A 6: 94,630,132 C160F probably damaging Het
Mapk13 T C 17: 28,775,558 I141T probably damaging Het
Mapkapk3 A G 9: 107,260,155 L175P probably damaging Het
Micall2 A G 5: 139,716,072 V472A unknown Het
Mmp15 T C 8: 95,366,331 F113L probably benign Het
Msh2 T G 17: 87,719,289 S738A probably benign Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myo1f T C 17: 33,576,450 V53A probably damaging Het
Ncf1 A T 5: 134,221,864 N367K probably benign Het
Nim1k C A 13: 119,712,582 V259F probably damaging Het
Nme8 T G 13: 19,690,214 I139L probably benign Het
Odam T C 5: 87,886,598 F46L probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr8 G A 10: 78,956,095 D297N possibly damaging Het
Pcdha9 A G 18: 36,998,901 E341G probably damaging Het
Pmepa1 T C 2: 173,276,169 T6A probably benign Het
Poglut1 A T 16: 38,534,806 D219E possibly damaging Het
Racgap1 A G 15: 99,636,197 S145P possibly damaging Het
Rasgef1a C T 6: 118,089,149 T441I possibly damaging Het
Rbm6 T C 9: 107,787,299 T844A probably benign Het
Ripk3 A G 14: 55,785,846 F134S probably benign Het
Rnf169 T C 7: 99,925,492 D632G possibly damaging Het
Sclt1 A T 3: 41,711,196 W146R probably benign Het
Setd5 T C 6: 113,121,794 F796S possibly damaging Het
Slc24a5 G T 2: 125,080,648 G110V probably damaging Het
Slc30a10 T A 1: 185,455,194 M44K probably damaging Het
Slc38a10 T A 11: 120,105,955 D772V probably benign Het
Thy1 C T 9: 44,046,707 T44I probably damaging Het
Tinagl1 G T 4: 130,167,478 S324Y probably benign Het
Tll2 T A 19: 41,104,997 Y477F probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmco6 T C 18: 36,741,666 L402P probably damaging Het
Uba7 T C 9: 107,975,802 V12A possibly damaging Het
Usp5 T C 6: 124,818,636 D598G probably damaging Het
Vmn1r158 C T 7: 22,790,044 V247I probably benign Het
Vpreb2 A G 16: 17,980,937 N96D probably damaging Het
Zcchc17 A T 4: 130,337,135 M87K probably damaging Het
Other mutations in Tnrc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tnrc18 APN 5 142763037 missense unknown
IGL01732:Tnrc18 APN 5 142772061 missense unknown
IGL01796:Tnrc18 APN 5 142764887 missense possibly damaging 0.88
IGL01868:Tnrc18 APN 5 142771812 missense unknown
IGL02010:Tnrc18 APN 5 142787294 missense unknown
IGL02566:Tnrc18 APN 5 142772313 splice site probably benign
IGL02688:Tnrc18 APN 5 142790172 missense probably damaging 0.96
IGL03052:Tnrc18 UTSW 5 142775219 missense unknown
R0129:Tnrc18 UTSW 5 142765045 splice site probably benign
R0617:Tnrc18 UTSW 5 142776739 missense unknown
R0894:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1056:Tnrc18 UTSW 5 142773859 nonsense probably null
R1084:Tnrc18 UTSW 5 142764767 critical splice donor site probably null
R1131:Tnrc18 UTSW 5 142787208 missense unknown
R1411:Tnrc18 UTSW 5 142765947 missense unknown
R1443:Tnrc18 UTSW 5 142771533 missense unknown
R1681:Tnrc18 UTSW 5 142773817 missense unknown
R1698:Tnrc18 UTSW 5 142788703 missense possibly damaging 0.83
R1795:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1903:Tnrc18 UTSW 5 142815140 missense probably damaging 0.99
R1930:Tnrc18 UTSW 5 142776324 missense unknown
R1931:Tnrc18 UTSW 5 142776324 missense unknown
R1941:Tnrc18 UTSW 5 142815150 missense probably damaging 1.00
R2069:Tnrc18 UTSW 5 142766087 missense unknown
R2074:Tnrc18 UTSW 5 142759706 splice site probably null
R2089:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2182:Tnrc18 UTSW 5 142760061 missense unknown
R2190:Tnrc18 UTSW 5 142775889 missense unknown
R2310:Tnrc18 UTSW 5 142788553 missense probably damaging 0.96
R2372:Tnrc18 UTSW 5 142759704 splice site probably benign
R2445:Tnrc18 UTSW 5 142772115 missense unknown
R3806:Tnrc18 UTSW 5 142787274 missense unknown
R4097:Tnrc18 UTSW 5 142773806 small deletion probably benign
R4153:Tnrc18 UTSW 5 142765992 missense possibly damaging 0.89
R4274:Tnrc18 UTSW 5 142743650 missense unknown
R4520:Tnrc18 UTSW 5 142732150 missense unknown
R4627:Tnrc18 UTSW 5 142740128 missense unknown
R4852:Tnrc18 UTSW 5 142731340 missense probably damaging 0.98
R4873:Tnrc18 UTSW 5 142765177 missense unknown
R4875:Tnrc18 UTSW 5 142765177 missense unknown
R4876:Tnrc18 UTSW 5 142731625 missense unknown
R4936:Tnrc18 UTSW 5 142765977 nonsense probably null
R4942:Tnrc18 UTSW 5 142787982 missense unknown
R4962:Tnrc18 UTSW 5 142739493 missense unknown
R5373:Tnrc18 UTSW 5 142740156 missense unknown
R5374:Tnrc18 UTSW 5 142740156 missense unknown
R5454:Tnrc18 UTSW 5 142771691 missense unknown
R5678:Tnrc18 UTSW 5 142733564 missense unknown
R5826:Tnrc18 UTSW 5 142773747 missense unknown
R5891:Tnrc18 UTSW 5 142815171 missense probably damaging 0.99
R6195:Tnrc18 UTSW 5 142765173 missense unknown
R6296:Tnrc18 UTSW 5 142733576 missense unknown
R6358:Tnrc18 UTSW 5 142727981 missense probably damaging 0.99
R6452:Tnrc18 UTSW 5 142727012 missense probably damaging 1.00
R6498:Tnrc18 UTSW 5 142732168 missense unknown
R6711:Tnrc18 UTSW 5 142787790 missense unknown
R6782:Tnrc18 UTSW 5 142787308 missense unknown
R6863:Tnrc18 UTSW 5 142815197 missense probably damaging 1.00
R6894:Tnrc18 UTSW 5 142760049 missense unknown
R6970:Tnrc18 UTSW 5 142727989 missense probably damaging 0.99
R7053:Tnrc18 UTSW 5 142787229 missense unknown
R7135:Tnrc18 UTSW 5 142787817 missense
R7756:Tnrc18 UTSW 5 142787152 missense
R7902:Tnrc18 UTSW 5 142772147 missense
R8039:Tnrc18 UTSW 5 142732052 missense unknown
R8053:Tnrc18 UTSW 5 142750630 missense unknown
R8322:Tnrc18 UTSW 5 142726012 missense probably damaging 1.00
R8379:Tnrc18 UTSW 5 142788402 missense
R8745:Tnrc18 UTSW 5 142787447 missense
R8837:Tnrc18 UTSW 5 142793056 missense possibly damaging 0.94
R8894:Tnrc18 UTSW 5 142739457 missense unknown
R8909:Tnrc18 UTSW 5 142776376 missense
R9030:Tnrc18 UTSW 5 142726063 missense probably damaging 1.00
R9186:Tnrc18 UTSW 5 142787733 missense
R9189:Tnrc18 UTSW 5 142731352 missense probably damaging 1.00
R9192:Tnrc18 UTSW 5 142787847 missense
R9230:Tnrc18 UTSW 5 142787637 missense
RF022:Tnrc18 UTSW 5 142773630 missense
Z1177:Tnrc18 UTSW 5 142773888 missense
Predicted Primers PCR Primer
(F):5'- TCAGGTTTCATGGTGCCCAG -3'
(R):5'- AGGAACTACTCAAGCCCGAG -3'

Sequencing Primer
(F):5'- AAAGGGGCTCTTCTTCCCACAG -3'
(R):5'- AGGCTGATCCGAGGCCTTG -3'
Posted On 2022-02-07