Incidental Mutation 'R9227:Olfr8'
ID 699943
Institutional Source Beutler Lab
Gene Symbol Olfr8
Ensembl Gene ENSMUSG00000094080
Gene Name olfactory receptor 8
Synonyms MOR139-5P, GA_x6K02T2QGN0-2857086-2856154
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock # R9227 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 78950636-78958378 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 78956095 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 297 (D297N)
Ref Sequence ENSEMBL: ENSMUSP00000144916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081571] [ENSMUST00000203851] [ENSMUST00000214952]
AlphaFold Q60892
Predicted Effect possibly damaging
Transcript: ENSMUST00000081571
AA Change: D297N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000080282
Gene: ENSMUSG00000094080
AA Change: D297N

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203851
AA Change: D297N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144916
Gene: ENSMUSG00000094080
AA Change: D297N

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 1.3e-47 PFAM
Pfam:7tm_1 42 291 3e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214952
AA Change: D297N

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A T 10: 77,321,792 F274I probably damaging Het
Adprhl1 C T 8: 13,221,974 V1595I probably benign Het
Anxa6 A G 11: 55,007,868 V160A probably benign Het
Appl1 T C 14: 26,923,735 E706G unknown Het
Arhgap21 T C 2: 20,855,658 T1313A possibly damaging Het
Armc2 T C 10: 41,947,939 Y511C probably damaging Het
Atp1a1 A T 3: 101,592,434 C111S probably damaging Het
Atp6v0d2 T A 4: 19,878,374 M300L probably benign Het
BC027072 A G 17: 71,750,222 L820P probably damaging Het
C1ra T C 6: 124,516,780 C164R probably damaging Het
Cacna1h T C 17: 25,380,882 Y1659C probably damaging Het
Catsperb T C 12: 101,549,794 I563T probably benign Het
Cd180 TA TAA 13: 102,705,006 probably null Het
Cd55b A T 1: 130,422,882 L26* probably null Het
Cdc42bpa A G 1: 180,106,073 N759S probably benign Het
Cenpj C T 14: 56,564,719 E130K possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chd7 C T 4: 8,805,272 S777L probably benign Het
Chrm3 C A 13: 9,878,443 V186L probably benign Het
Clrn2 A G 5: 45,463,941 T226A probably damaging Het
Col3a1 C T 1: 45,343,978 P1071S unknown Het
Dytn A T 1: 63,647,452 V353D probably benign Het
Egfem1 G A 3: 29,357,168 E155K probably benign Het
Eif3m A T 2: 105,001,360 M285K probably damaging Het
Fam135b T C 15: 71,464,007 K446R probably benign Het
Fam186a T C 15: 99,955,503 T119A unknown Het
Frmd4a T C 2: 4,608,033 S1025P possibly damaging Het
Fubp3 A G 2: 31,612,552 H449R probably benign Het
Fyco1 A T 9: 123,819,146 I1241N probably damaging Het
Gabpb2 A T 3: 95,204,687 M77K probably damaging Het
Gfpt1 T A 6: 87,050,924 I4K probably damaging Het
Gif G A 19: 11,760,384 W386* probably null Het
Glis1 T C 4: 107,568,130 S313P probably benign Het
Gm3376 T G Y: 3,774,819 D5E probably damaging Het
Golga4 T A 9: 118,556,873 M1021K possibly damaging Het
Grid2ip G A 5: 143,373,439 R270Q probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Ifit1 A G 19: 34,647,836 E124G possibly damaging Het
Ifna14 T C 4: 88,571,515 D95G probably benign Het
Ilkap A C 1: 91,387,215 I142S probably benign Het
Inpp5e C T 2: 26,398,604 R588H probably damaging Het
Kif1b A C 4: 149,237,900 M854R probably damaging Het
Lcn6 A T 2: 25,680,095 K91M probably damaging Het
Lpin1 A T 12: 16,538,482 S902R unknown Het
Lrig1 C A 6: 94,630,132 C160F probably damaging Het
Mapk13 T C 17: 28,775,558 I141T probably damaging Het
Mapkapk3 A G 9: 107,260,155 L175P probably damaging Het
Micall2 A G 5: 139,716,072 V472A unknown Het
Mmp15 T C 8: 95,366,331 F113L probably benign Het
Msh2 T G 17: 87,719,289 S738A probably benign Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myo1f T C 17: 33,576,450 V53A probably damaging Het
Ncf1 A T 5: 134,221,864 N367K probably benign Het
Nim1k C A 13: 119,712,582 V259F probably damaging Het
Nme8 T G 13: 19,690,214 I139L probably benign Het
Odam T C 5: 87,886,598 F46L probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Pcdha9 A G 18: 36,998,901 E341G probably damaging Het
Pmepa1 T C 2: 173,276,169 T6A probably benign Het
Poglut1 A T 16: 38,534,806 D219E possibly damaging Het
Racgap1 A G 15: 99,636,197 S145P possibly damaging Het
Rasgef1a C T 6: 118,089,149 T441I possibly damaging Het
Rbm6 T C 9: 107,787,299 T844A probably benign Het
Rell1 T C 5: 63,939,762 probably benign Het
Ripk3 A G 14: 55,785,846 F134S probably benign Het
Rnf169 T C 7: 99,925,492 D632G possibly damaging Het
Sclt1 A T 3: 41,711,196 W146R probably benign Het
Setd5 T C 6: 113,121,794 F796S possibly damaging Het
Slc24a5 G T 2: 125,080,648 G110V probably damaging Het
Slc30a10 T A 1: 185,455,194 M44K probably damaging Het
Slc38a10 T A 11: 120,105,955 D772V probably benign Het
Thy1 C T 9: 44,046,707 T44I probably damaging Het
Tinagl1 G T 4: 130,167,478 S324Y probably benign Het
Tll2 T A 19: 41,104,997 Y477F probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmco6 T C 18: 36,741,666 L402P probably damaging Het
Tnrc18 G T 5: 142,787,637 A479D Het
Uba7 T C 9: 107,975,802 V12A possibly damaging Het
Usp5 T C 6: 124,818,636 D598G probably damaging Het
Vmn1r158 C T 7: 22,790,044 V247I probably benign Het
Vpreb2 A G 16: 17,980,937 N96D probably damaging Het
Zcchc17 A T 4: 130,337,135 M87K probably damaging Het
Other mutations in Olfr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Olfr8 APN 10 78955354 missense possibly damaging 0.48
IGL01480:Olfr8 APN 10 78956144 utr 3 prime probably benign
IGL02505:Olfr8 APN 10 78955933 missense probably benign 0.02
IGL02543:Olfr8 APN 10 78955939 missense probably damaging 1.00
IGL03323:Olfr8 APN 10 78955600 missense probably benign
PIT4466001:Olfr8 UTSW 10 78955842 missense probably benign 0.00
R1496:Olfr8 UTSW 10 78955848 missense probably benign 0.41
R1754:Olfr8 UTSW 10 78955697 missense probably damaging 0.99
R1878:Olfr8 UTSW 10 78955805 missense possibly damaging 0.62
R2760:Olfr8 UTSW 10 78956042 missense probably damaging 0.99
R4202:Olfr8 UTSW 10 78955295 missense probably benign
R4206:Olfr8 UTSW 10 78955283 missense probably benign 0.00
R4517:Olfr8 UTSW 10 78956043 nonsense probably null
R4613:Olfr8 UTSW 10 78956065 missense probably damaging 1.00
R4799:Olfr8 UTSW 10 78956097 missense probably null 0.92
R4979:Olfr8 UTSW 10 78955932 nonsense probably null
R5008:Olfr8 UTSW 10 78956071 missense probably damaging 1.00
R5700:Olfr8 UTSW 10 78955484 missense probably damaging 1.00
R5876:Olfr8 UTSW 10 78955357 missense probably benign 0.15
R6439:Olfr8 UTSW 10 78955984 missense probably damaging 1.00
R6930:Olfr8 UTSW 10 78955781 missense possibly damaging 0.84
R7110:Olfr8 UTSW 10 78955450 missense possibly damaging 0.83
R7405:Olfr8 UTSW 10 78955697 missense probably benign 0.14
R7524:Olfr8 UTSW 10 78955491 nonsense probably null
R8198:Olfr8 UTSW 10 78955724 missense probably damaging 0.97
R9230:Olfr8 UTSW 10 78956095 missense possibly damaging 0.92
Z1176:Olfr8 UTSW 10 78955219 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTACACGGCATTTTCTACATG -3'
(R):5'- GTGTGGGATATCATAGGCGC -3'

Sequencing Primer
(F):5'- ACACGGCATTTTCTACATGTGTCTC -3'
(R):5'- AAGGGTGATGCATCCCTTGAATC -3'
Posted On 2022-02-07