Incidental Mutation 'R9227:Chrm3'
ID 699948
Institutional Source Beutler Lab
Gene Symbol Chrm3
Ensembl Gene ENSMUSG00000046159
Gene Name cholinergic receptor, muscarinic 3, cardiac
Synonyms muscarinic acetylcholine receptor 3, Chrm-3, M3R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R9227 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 9875486-10360847 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 9878443 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 186 (V186L)
Ref Sequence ENSEMBL: ENSMUSP00000140131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063093] [ENSMUST00000187510]
AlphaFold Q9ERZ3
Predicted Effect probably benign
Transcript: ENSMUST00000063093
AA Change: V186L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000055579
Gene: ENSMUSG00000046159
AA Change: V186L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.9e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 6.9e-82 PFAM
low complexity region 564 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187510
AA Change: V186L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140131
Gene: ENSMUSG00000046159
AA Change: V186L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 75 265 8.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 78 270 6e-11 PFAM
Pfam:7tm_1 84 543 2.6e-88 PFAM
low complexity region 564 576 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 3 controls smooth muscle contraction and its stimulation causes secretion of glandular tissue. Alternative promoter use and alternative splicing results in multiple transcript variants that have different tissue specificities. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null mice show reduced body weight and gonadal fat pad weight, decreased food intake, and low serum levels of leptin, triglycerides and insulin. Dilated pupils, hydronephrosis, and impaired contractility of smooth muscle are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adarb1 A T 10: 77,321,792 F274I probably damaging Het
Adprhl1 C T 8: 13,221,974 V1595I probably benign Het
Anxa6 A G 11: 55,007,868 V160A probably benign Het
Appl1 T C 14: 26,923,735 E706G unknown Het
Arhgap21 T C 2: 20,855,658 T1313A possibly damaging Het
Armc2 T C 10: 41,947,939 Y511C probably damaging Het
Atp1a1 A T 3: 101,592,434 C111S probably damaging Het
Atp6v0d2 T A 4: 19,878,374 M300L probably benign Het
BC027072 A G 17: 71,750,222 L820P probably damaging Het
C1ra T C 6: 124,516,780 C164R probably damaging Het
Cacna1h T C 17: 25,380,882 Y1659C probably damaging Het
Catsperb T C 12: 101,549,794 I563T probably benign Het
Cd180 TA TAA 13: 102,705,006 probably null Het
Cd55b A T 1: 130,422,882 L26* probably null Het
Cdc42bpa A G 1: 180,106,073 N759S probably benign Het
Cenpj C T 14: 56,564,719 E130K possibly damaging Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chd7 C T 4: 8,805,272 S777L probably benign Het
Clrn2 A G 5: 45,463,941 T226A probably damaging Het
Col3a1 C T 1: 45,343,978 P1071S unknown Het
Dytn A T 1: 63,647,452 V353D probably benign Het
Egfem1 G A 3: 29,357,168 E155K probably benign Het
Eif3m A T 2: 105,001,360 M285K probably damaging Het
Fam135b T C 15: 71,464,007 K446R probably benign Het
Fam186a T C 15: 99,955,503 T119A unknown Het
Frmd4a T C 2: 4,608,033 S1025P possibly damaging Het
Fubp3 A G 2: 31,612,552 H449R probably benign Het
Fyco1 A T 9: 123,819,146 I1241N probably damaging Het
Gabpb2 A T 3: 95,204,687 M77K probably damaging Het
Gfpt1 T A 6: 87,050,924 I4K probably damaging Het
Gif G A 19: 11,760,384 W386* probably null Het
Glis1 T C 4: 107,568,130 S313P probably benign Het
Gm3376 T G Y: 3,774,819 D5E probably damaging Het
Golga4 T A 9: 118,556,873 M1021K possibly damaging Het
Grid2ip G A 5: 143,373,439 R270Q probably damaging Het
Hps4 G A 5: 112,378,039 S642N possibly damaging Het
Ifit1 A G 19: 34,647,836 E124G possibly damaging Het
Ifna14 T C 4: 88,571,515 D95G probably benign Het
Ilkap A C 1: 91,387,215 I142S probably benign Het
Inpp5e C T 2: 26,398,604 R588H probably damaging Het
Kif1b A C 4: 149,237,900 M854R probably damaging Het
Lcn6 A T 2: 25,680,095 K91M probably damaging Het
Lpin1 A T 12: 16,538,482 S902R unknown Het
Lrig1 C A 6: 94,630,132 C160F probably damaging Het
Mapk13 T C 17: 28,775,558 I141T probably damaging Het
Mapkapk3 A G 9: 107,260,155 L175P probably damaging Het
Micall2 A G 5: 139,716,072 V472A unknown Het
Mmp15 T C 8: 95,366,331 F113L probably benign Het
Msh2 T G 17: 87,719,289 S738A probably benign Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myo1f T C 17: 33,576,450 V53A probably damaging Het
Ncf1 A T 5: 134,221,864 N367K probably benign Het
Nim1k C A 13: 119,712,582 V259F probably damaging Het
Nme8 T G 13: 19,690,214 I139L probably benign Het
Odam T C 5: 87,886,598 F46L probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr8 G A 10: 78,956,095 D297N possibly damaging Het
Pcdha9 A G 18: 36,998,901 E341G probably damaging Het
Pmepa1 T C 2: 173,276,169 T6A probably benign Het
Poglut1 A T 16: 38,534,806 D219E possibly damaging Het
Racgap1 A G 15: 99,636,197 S145P possibly damaging Het
Rasgef1a C T 6: 118,089,149 T441I possibly damaging Het
Rbm6 T C 9: 107,787,299 T844A probably benign Het
Rell1 T C 5: 63,939,762 probably benign Het
Ripk3 A G 14: 55,785,846 F134S probably benign Het
Rnf169 T C 7: 99,925,492 D632G possibly damaging Het
Sclt1 A T 3: 41,711,196 W146R probably benign Het
Setd5 T C 6: 113,121,794 F796S possibly damaging Het
Slc24a5 G T 2: 125,080,648 G110V probably damaging Het
Slc30a10 T A 1: 185,455,194 M44K probably damaging Het
Slc38a10 T A 11: 120,105,955 D772V probably benign Het
Thy1 C T 9: 44,046,707 T44I probably damaging Het
Tinagl1 G T 4: 130,167,478 S324Y probably benign Het
Tll2 T A 19: 41,104,997 Y477F probably benign Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tmco6 T C 18: 36,741,666 L402P probably damaging Het
Tnrc18 G T 5: 142,787,637 A479D Het
Uba7 T C 9: 107,975,802 V12A possibly damaging Het
Usp5 T C 6: 124,818,636 D598G probably damaging Het
Vmn1r158 C T 7: 22,790,044 V247I probably benign Het
Vpreb2 A G 16: 17,980,937 N96D probably damaging Het
Zcchc17 A T 4: 130,337,135 M87K probably damaging Het
Other mutations in Chrm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01608:Chrm3 APN 13 9878598 missense possibly damaging 0.80
IGL02266:Chrm3 APN 13 9877278 missense probably damaging 0.99
IGL02701:Chrm3 APN 13 9878464 nonsense probably null
IGL03085:Chrm3 APN 13 9877534 missense probably damaging 1.00
IGL03213:Chrm3 APN 13 9878184 missense probably benign 0.22
R0147:Chrm3 UTSW 13 9878744 missense probably damaging 1.00
R0408:Chrm3 UTSW 13 9877933 missense probably benign 0.10
R0544:Chrm3 UTSW 13 9877579 missense probably damaging 0.99
R1557:Chrm3 UTSW 13 9878314 missense possibly damaging 0.82
R1647:Chrm3 UTSW 13 9878425 missense probably damaging 1.00
R1697:Chrm3 UTSW 13 9878758 missense probably damaging 1.00
R1791:Chrm3 UTSW 13 9877416 missense probably damaging 1.00
R1866:Chrm3 UTSW 13 9878481 missense probably damaging 1.00
R2049:Chrm3 UTSW 13 9878335 missense probably damaging 1.00
R2909:Chrm3 UTSW 13 9877997 missense probably benign 0.43
R4212:Chrm3 UTSW 13 9877755 missense probably benign 0.01
R4422:Chrm3 UTSW 13 9878555 nonsense probably null
R4790:Chrm3 UTSW 13 9877662 missense probably benign 0.10
R4934:Chrm3 UTSW 13 9877414 missense probably damaging 1.00
R5353:Chrm3 UTSW 13 9878557 missense probably damaging 1.00
R5623:Chrm3 UTSW 13 9877387 missense possibly damaging 0.92
R6154:Chrm3 UTSW 13 9878440 missense possibly damaging 0.88
R6416:Chrm3 UTSW 13 9877662 missense probably benign
R6693:Chrm3 UTSW 13 9877422 missense probably benign 0.27
R7135:Chrm3 UTSW 13 9877801 missense probably benign 0.00
R7297:Chrm3 UTSW 13 9877833 missense probably benign 0.01
R7423:Chrm3 UTSW 13 9878809 missense probably benign
R7591:Chrm3 UTSW 13 9877313 nonsense probably null
R8353:Chrm3 UTSW 13 9877231 makesense probably null
R8355:Chrm3 UTSW 13 9878610 missense probably damaging 1.00
R8446:Chrm3 UTSW 13 9878302 missense probably damaging 0.99
R8453:Chrm3 UTSW 13 9877231 makesense probably null
R9230:Chrm3 UTSW 13 9878443 missense probably benign 0.00
R9336:Chrm3 UTSW 13 9878616 missense probably damaging 1.00
R9462:Chrm3 UTSW 13 9877401 missense
R9537:Chrm3 UTSW 13 9877426 missense probably damaging 1.00
R9586:Chrm3 UTSW 13 9877444 missense probably damaging 1.00
X0066:Chrm3 UTSW 13 9877720 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCTCTTTGGTACGTTTCTCAG -3'
(R):5'- CATTATGAACCGCTGGGCTC -3'

Sequencing Primer
(F):5'- GGTACGTTTCTCAGTCTCCTTATAG -3'
(R):5'- CTCTGGGGAACTTAGCCTGTGAC -3'
Posted On 2022-02-07