Incidental Mutation 'R9228:Igsf10'
ID 699990
Institutional Source Beutler Lab
Gene Symbol Igsf10
Ensembl Gene ENSMUSG00000036334
Gene Name immunoglobulin superfamily, member 10
Synonyms Adlican2, CMF608, 6530405F15Rik
Accession Numbers

Genbank: NM_001162884; MGI: 1923481

Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock # R9228 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 59316735-59344394 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 59336422 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 164 (R164W)
Ref Sequence ENSEMBL: ENSMUSP00000037246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000193455] [ENSMUST00000194546] [ENSMUST00000195983]
AlphaFold Q3V1M1
Predicted Effect probably damaging
Transcript: ENSMUST00000039419
AA Change: R164W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: R164W

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000193455
AA Change: R164W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: R164W

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194546
AA Change: R164W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: R164W

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 3.24e-4 SMART
LRR 57 79 9.24e1 SMART
LRR 80 103 2.02e-1 SMART
LRR 104 127 7.16e0 SMART
LRR_TYP 128 151 1.2e-3 SMART
LRR 152 175 1.25e-1 SMART
LRR 188 207 2.33e2 SMART
LRRCT 219 280 4.19e-4 SMART
IGc2 488 558 2.34e-4 SMART
IGc2 586 652 7.88e-11 SMART
low complexity region 917 930 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
low complexity region 1245 1263 N/A INTRINSIC
low complexity region 1311 1321 N/A INTRINSIC
low complexity region 1449 1465 N/A INTRINSIC
IGc2 1632 1701 7.69e-14 SMART
IGc2 1729 1798 5.07e-14 SMART
IGc2 1826 1895 2.19e-9 SMART
IGc2 1925 1994 4.59e-12 SMART
IGc2 2022 2097 1.33e-8 SMART
IGc2 2125 2191 2.96e-15 SMART
IGc2 2223 2291 2.03e-4 SMART
IGc2 2321 2389 9.99e-13 SMART
IGc2 2416 2484 3.03e-12 SMART
IGc2 2512 2583 7.76e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195983
SMART Domains Protein: ENSMUSP00000143071
Gene: ENSMUSG00000036334

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRRNT 28 61 1.5e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810037I17Rik G A 3: 122,924,625 A56T probably benign Het
2310050C09Rik C T 3: 92,868,644 G244D probably benign Het
4930438A08Rik A T 11: 58,287,470 I119F Het
Abca12 A T 1: 71,293,440 I1254N probably damaging Het
Abcb11 G T 2: 69,308,465 Y157* probably null Het
Adcy7 G A 8: 88,318,047 probably null Het
Adnp A G 2: 168,184,878 Y166H probably damaging Het
Adprhl1 A G 8: 13,225,279 V493A probably benign Het
Ahctf1 T C 1: 179,784,120 T562A probably benign Het
Amotl1 T A 9: 14,593,024 N296I possibly damaging Het
Ankar A G 1: 72,674,051 V693A probably benign Het
Ankrd16 T C 2: 11,781,507 V189A probably benign Het
Bmp1 A G 14: 70,519,898 L47P probably benign Het
Cacna2d4 A G 6: 119,271,515 D429G probably benign Het
Cadps2 T A 6: 23,688,928 E127D probably benign Het
Cd109 A T 9: 78,669,760 I580F possibly damaging Het
Cdrt4 T A 11: 62,951,298 I2N unknown Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chuk A T 19: 44,107,350 W15R probably damaging Het
Cpvl C T 6: 53,974,794 M1I probably null Het
Cyfip1 A G 7: 55,900,010 M642V probably damaging Het
Dhh T A 15: 98,897,876 R133* probably null Het
Dnmt3b G A 2: 153,666,060 V212M probably benign Het
Dync2li1 A G 17: 84,649,709 S301G probably benign Het
Epas1 A C 17: 86,826,562 I500L possibly damaging Het
Ephb4 A T 5: 137,354,562 I136F possibly damaging Het
Foxg1 T C 12: 49,384,537 F18L unknown Het
Frem1 T C 4: 83,001,820 E432G probably damaging Het
Gm5591 T A 7: 38,528,061 M1L probably benign Het
Gpld1 A T 13: 24,952,917 S73C probably damaging Het
Hddc3 A G 7: 80,343,580 I52V probably benign Het
Hmgcll1 A T 9: 76,084,450 T252S probably damaging Het
Jph2 A G 2: 163,338,686 V675A probably benign Het
Kifap3 T C 1: 163,862,097 F550S probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
L1td1 T C 4: 98,737,695 V643A possibly damaging Het
L3mbtl3 C T 10: 26,336,257 M255I unknown Het
Layn T A 9: 51,057,537 D302V probably damaging Het
Lpcat4 A G 2: 112,242,073 I136V possibly damaging Het
Lrp1 T A 10: 127,546,938 D3658V probably damaging Het
Metap1d T C 2: 71,522,556 L243S possibly damaging Het
Midn T A 10: 80,154,441 H315Q probably damaging Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myh2 T C 11: 67,186,696 S886P probably benign Het
Nemf T C 12: 69,341,319 I396V probably damaging Het
Nemp1 T G 10: 127,689,358 V127G possibly damaging Het
Nkx3-1 C T 14: 69,190,778 T25M possibly damaging Het
Nmral1 A C 16: 4,713,767 L208R probably damaging Het
Nol6 A T 4: 41,116,422 I989N probably benign Het
Olfr1126 T A 2: 87,457,563 C133S possibly damaging Het
Palld A T 8: 61,720,537 S363T probably damaging Het
Pcdha11 A G 18: 37,011,459 D201G probably damaging Het
Per2 A G 1: 91,438,359 C339R probably damaging Het
Phactr4 T C 4: 132,370,563 T455A possibly damaging Het
Phc2 T C 4: 128,723,269 I445T probably damaging Het
Polr1a T C 6: 71,954,771 F945L probably damaging Het
Ppp2r5e T A 12: 75,593,289 K13* probably null Het
Ptafr T C 4: 132,579,302 M1T probably null Het
Rbms1 G A 2: 60,779,743 P208S probably benign Het
Scg3 T A 9: 75,651,673 I419F probably damaging Het
Scn1a T C 2: 66,299,755 T219A probably benign Het
Sec14l4 A G 11: 4,039,977 D92G probably damaging Het
Senp3 G T 11: 69,678,259 Q359K probably damaging Het
Sirt1 T C 10: 63,337,078 D142G probably damaging Het
Skint2 T C 4: 112,625,842 M148T possibly damaging Het
Skiv2l2 A T 13: 112,914,354 probably null Het
Slc30a10 T A 1: 185,455,194 M44K probably damaging Het
Snai2 T A 16: 14,706,928 D99E probably damaging Het
Spg7 A G 8: 123,080,669 K395E possibly damaging Het
Sphk2 G A 7: 45,710,913 H556Y possibly damaging Het
Supt6 A C 11: 78,225,786 F637L probably benign Het
Tcam1 A G 11: 106,286,466 N428S probably damaging Het
Tctn3 C T 19: 40,608,248 R276K probably benign Het
Timm29 G A 9: 21,593,360 R108H probably damaging Het
Tlr9 A T 9: 106,225,553 E681V possibly damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tns3 T C 11: 8,450,094 K1169E probably damaging Het
Trim72 A C 7: 128,009,143 D271A possibly damaging Het
Trpv4 A T 5: 114,634,561 D369E probably benign Het
Ttn A G 2: 76,752,848 L22567P probably damaging Het
Uimc1 G A 13: 55,075,839 P207S probably damaging Het
Unc5d A T 8: 28,675,420 V781E probably damaging Het
Upk3bl C T 5: 136,057,222 P4L unknown Het
Vmn1r201 A G 13: 22,475,500 N295D probably benign Het
Vmn2r69 A G 7: 85,415,489 I63T probably benign Het
Zfyve28 T C 5: 34,217,444 T409A probably benign Het
Other mutations in Igsf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Igsf10 APN 3 59331539 missense probably benign 0.03
IGL00790:Igsf10 APN 3 59319517 missense probably damaging 1.00
IGL00916:Igsf10 APN 3 59331127 missense probably damaging 0.97
IGL00928:Igsf10 APN 3 59330597 missense probably benign 0.00
IGL01066:Igsf10 APN 3 59327782 critical splice donor site probably null
IGL01107:Igsf10 APN 3 59331524 missense probably damaging 1.00
IGL01420:Igsf10 APN 3 59319650 missense probably benign 0.02
IGL01533:Igsf10 APN 3 59319230 missense probably damaging 0.98
IGL01537:Igsf10 APN 3 59330031 missense probably benign 0.00
IGL01676:Igsf10 APN 3 59326011 missense probably benign 0.06
IGL01676:Igsf10 APN 3 59329335 missense probably benign 0.17
IGL01960:Igsf10 APN 3 59318737 missense probably benign 0.00
IGL02123:Igsf10 APN 3 59318660 missense probably damaging 0.97
IGL02198:Igsf10 APN 3 59325978 missense possibly damaging 0.95
IGL02268:Igsf10 APN 3 59331152 nonsense probably null
IGL02313:Igsf10 APN 3 59330690 missense probably benign 0.01
IGL02368:Igsf10 APN 3 59328231 missense probably benign
IGL02494:Igsf10 APN 3 59328006 missense probably damaging 0.98
IGL02549:Igsf10 APN 3 59329241 missense probably benign 0.03
IGL02616:Igsf10 APN 3 59318606 missense probably benign 0.06
IGL02957:Igsf10 APN 3 59330864 missense probably damaging 1.00
IGL03067:Igsf10 APN 3 59318918 missense probably benign 0.25
IGL03104:Igsf10 APN 3 59319484 missense probably damaging 1.00
IGL03124:Igsf10 APN 3 59319665 missense probably benign 0.01
IGL03212:Igsf10 APN 3 59328165 missense probably benign 0.09
IGL03347:Igsf10 APN 3 59331900 missense possibly damaging 0.94
IGL03357:Igsf10 APN 3 59336211 missense probably benign 0.35
F6893:Igsf10 UTSW 3 59331060 missense probably damaging 1.00
FR4449:Igsf10 UTSW 3 59319110 missense probably damaging 1.00
PIT1430001:Igsf10 UTSW 3 59328158 missense probably benign 0.06
PIT4402001:Igsf10 UTSW 3 59325579 missense probably benign 0.00
PIT4810001:Igsf10 UTSW 3 59318482 missense probably damaging 1.00
R0068:Igsf10 UTSW 3 59330624 missense probably damaging 0.98
R0095:Igsf10 UTSW 3 59331196 nonsense probably null
R0095:Igsf10 UTSW 3 59331196 nonsense probably null
R0112:Igsf10 UTSW 3 59326008 missense probably benign 0.00
R0141:Igsf10 UTSW 3 59330832 missense probably damaging 1.00
R0538:Igsf10 UTSW 3 59320106 missense probably damaging 0.99
R0551:Igsf10 UTSW 3 59328668 missense probably benign 0.01
R0556:Igsf10 UTSW 3 59328875 missense probably benign 0.02
R0582:Igsf10 UTSW 3 59319767 missense probably benign 0.00
R0630:Igsf10 UTSW 3 59326062 missense probably damaging 1.00
R0675:Igsf10 UTSW 3 59328594 missense probably benign 0.14
R0948:Igsf10 UTSW 3 59331104 missense probably damaging 1.00
R1252:Igsf10 UTSW 3 59331848 missense probably benign 0.03
R1412:Igsf10 UTSW 3 59327775 splice site probably benign
R1473:Igsf10 UTSW 3 59318767 missense probably damaging 1.00
R1585:Igsf10 UTSW 3 59330417 missense probably damaging 1.00
R1650:Igsf10 UTSW 3 59326162 missense probably damaging 1.00
R1660:Igsf10 UTSW 3 59331285 missense probably damaging 1.00
R1671:Igsf10 UTSW 3 59328500 nonsense probably null
R1748:Igsf10 UTSW 3 59319093 missense probably damaging 1.00
R1758:Igsf10 UTSW 3 59329196 missense probably benign 0.09
R1856:Igsf10 UTSW 3 59331272 missense possibly damaging 0.63
R1912:Igsf10 UTSW 3 59329572 missense probably benign 0.40
R2148:Igsf10 UTSW 3 59336577 missense possibly damaging 0.77
R2155:Igsf10 UTSW 3 59331680 missense probably damaging 1.00
R2509:Igsf10 UTSW 3 59331866 missense probably damaging 1.00
R2511:Igsf10 UTSW 3 59331866 missense probably damaging 1.00
R2680:Igsf10 UTSW 3 59325454 missense probably benign 0.14
R2913:Igsf10 UTSW 3 59331736 missense possibly damaging 0.70
R2927:Igsf10 UTSW 3 59329427 missense probably benign
R3547:Igsf10 UTSW 3 59330541 missense probably benign 0.02
R3547:Igsf10 UTSW 3 59336514 missense probably damaging 1.00
R3548:Igsf10 UTSW 3 59336514 missense probably damaging 1.00
R3620:Igsf10 UTSW 3 59336331 missense probably damaging 1.00
R3732:Igsf10 UTSW 3 59325714 missense probably benign 0.29
R3743:Igsf10 UTSW 3 59326125 missense possibly damaging 0.69
R3973:Igsf10 UTSW 3 59331924 missense probably damaging 1.00
R4005:Igsf10 UTSW 3 59328560 missense probably benign 0.00
R4184:Igsf10 UTSW 3 59319731 missense probably damaging 1.00
R4302:Igsf10 UTSW 3 59318750 missense probably damaging 1.00
R4404:Igsf10 UTSW 3 59329551 missense probably benign 0.04
R4575:Igsf10 UTSW 3 59330100 missense probably benign
R4676:Igsf10 UTSW 3 59325949 missense probably benign 0.23
R4700:Igsf10 UTSW 3 59320330 missense probably damaging 0.99
R4765:Igsf10 UTSW 3 59329705 missense probably benign 0.01
R4986:Igsf10 UTSW 3 59328606 missense probably benign 0.24
R5012:Igsf10 UTSW 3 59318722 missense probably damaging 1.00
R5070:Igsf10 UTSW 3 59328293 missense probably benign 0.02
R5083:Igsf10 UTSW 3 59326273 missense probably damaging 1.00
R5336:Igsf10 UTSW 3 59320132 missense probably damaging 1.00
R5462:Igsf10 UTSW 3 59325754 missense probably damaging 1.00
R5648:Igsf10 UTSW 3 59328153 missense probably benign 0.01
R5810:Igsf10 UTSW 3 59319071 missense probably damaging 1.00
R5871:Igsf10 UTSW 3 59330411 missense possibly damaging 0.83
R5880:Igsf10 UTSW 3 59330831 missense probably damaging 1.00
R5935:Igsf10 UTSW 3 59328157 missense probably benign 0.12
R5979:Igsf10 UTSW 3 59336473 missense probably damaging 1.00
R6145:Igsf10 UTSW 3 59331656 missense possibly damaging 0.83
R6222:Igsf10 UTSW 3 59318915 missense possibly damaging 0.90
R6224:Igsf10 UTSW 3 59325510 missense probably damaging 1.00
R6264:Igsf10 UTSW 3 59328507 missense possibly damaging 0.88
R6283:Igsf10 UTSW 3 59319449 missense probably damaging 1.00
R6336:Igsf10 UTSW 3 59330339 missense probably benign 0.00
R6490:Igsf10 UTSW 3 59329571 missense probably benign 0.06
R6785:Igsf10 UTSW 3 59319244 missense probably damaging 1.00
R6873:Igsf10 UTSW 3 59328444 missense probably benign
R6889:Igsf10 UTSW 3 59331933 missense probably benign
R7024:Igsf10 UTSW 3 59331701 missense probably benign 0.00
R7056:Igsf10 UTSW 3 59331080 missense probably damaging 1.00
R7128:Igsf10 UTSW 3 59328905 missense probably benign
R7251:Igsf10 UTSW 3 59319454 missense probably damaging 1.00
R7313:Igsf10 UTSW 3 59329416 missense probably benign 0.05
R7340:Igsf10 UTSW 3 59325768 missense probably damaging 1.00
R7447:Igsf10 UTSW 3 59331801 missense probably benign 0.39
R7506:Igsf10 UTSW 3 59319354 missense probably damaging 1.00
R7678:Igsf10 UTSW 3 59319340 missense possibly damaging 0.81
R7695:Igsf10 UTSW 3 59326191 missense probably damaging 1.00
R7709:Igsf10 UTSW 3 59331543 missense probably damaging 0.96
R7749:Igsf10 UTSW 3 59329128 missense possibly damaging 0.88
R7808:Igsf10 UTSW 3 59328068 missense probably benign 0.00
R7850:Igsf10 UTSW 3 59319632 missense probably benign 0.33
R7879:Igsf10 UTSW 3 59330724 missense probably damaging 1.00
R7886:Igsf10 UTSW 3 59328327 missense probably benign 0.01
R7891:Igsf10 UTSW 3 59328411 nonsense probably null
R7946:Igsf10 UTSW 3 59319704 missense possibly damaging 0.69
R7948:Igsf10 UTSW 3 59331858 missense probably benign 0.02
R8004:Igsf10 UTSW 3 59329709 missense probably benign 0.01
R8096:Igsf10 UTSW 3 59328959 missense probably damaging 0.98
R8141:Igsf10 UTSW 3 59330528 missense probably damaging 0.96
R8183:Igsf10 UTSW 3 59330615 missense probably benign 0.04
R8203:Igsf10 UTSW 3 59328833 missense probably benign 0.11
R8325:Igsf10 UTSW 3 59318533 missense probably damaging 0.96
R8350:Igsf10 UTSW 3 59331528 missense probably damaging 1.00
R8387:Igsf10 UTSW 3 59329143 missense probably damaging 1.00
R8488:Igsf10 UTSW 3 59320010 missense probably damaging 1.00
R8697:Igsf10 UTSW 3 59318887 missense probably benign 0.02
R8786:Igsf10 UTSW 3 59330642 missense probably benign 0.25
R8804:Igsf10 UTSW 3 59336455 missense probably damaging 1.00
R8886:Igsf10 UTSW 3 59329989 missense probably benign 0.00
R8902:Igsf10 UTSW 3 59336212 missense probably benign 0.00
R8906:Igsf10 UTSW 3 59326318 missense probably benign 0.01
R8917:Igsf10 UTSW 3 59319467 missense possibly damaging 0.69
R9051:Igsf10 UTSW 3 59329247 missense probably benign 0.00
R9178:Igsf10 UTSW 3 59326059 missense possibly damaging 0.69
R9230:Igsf10 UTSW 3 59336422 missense probably damaging 1.00
R9231:Igsf10 UTSW 3 59336422 missense probably damaging 1.00
R9232:Igsf10 UTSW 3 59336422 missense probably damaging 1.00
R9417:Igsf10 UTSW 3 59329105 missense possibly damaging 0.94
Z1088:Igsf10 UTSW 3 59329938 missense possibly damaging 0.59
Z1177:Igsf10 UTSW 3 59329605 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCACAGGTCCATGGGTTTC -3'
(R):5'- CTCTCTTTGTGAAAGTTCCTTTGAG -3'

Sequencing Primer
(F):5'- CCATGCAAGTAAAGGCTTTCTAGG -3'
(R):5'- GTTCCTTTGAGAAAACAAATATGCCC -3'
Posted On 2022-02-07