Incidental Mutation 'R9228:Cadps2'
ID 700004
Institutional Source Beutler Lab
Gene Symbol Cadps2
Ensembl Gene ENSMUSG00000017978
Gene Name Ca2+-dependent activator protein for secretion 2
Synonyms Caps2, cpd2, A230044C21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9228 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 23262773-23839421 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 23688928 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 127 (E127D)
Ref Sequence ENSEMBL: ENSMUSP00000111018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018122] [ENSMUST00000069074] [ENSMUST00000115356] [ENSMUST00000115358] [ENSMUST00000115361] [ENSMUST00000142913] [ENSMUST00000163871] [ENSMUST00000166458]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000018122
AA Change: E127D

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000018122
Gene: ENSMUSG00000017978
AA Change: E127D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069074
AA Change: E127D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000064876
Gene: ENSMUSG00000017978
AA Change: E127D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 895 5.54e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115356
AA Change: E127D

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111013
Gene: ENSMUSG00000017978
AA Change: E127D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115358
AA Change: E127D

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000111015
Gene: ENSMUSG00000017978
AA Change: E127D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115361
AA Change: E127D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000111018
Gene: ENSMUSG00000017978
AA Change: E127D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 892 1.9e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142913
AA Change: E98D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138167
Gene: ENSMUSG00000017978
AA Change: E98D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 22 39 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.14e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163871
AA Change: E127D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128905
Gene: ENSMUSG00000017978
AA Change: E127D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 31 65 N/A INTRINSIC
low complexity region 114 126 N/A INTRINSIC
coiled coil region 265 285 N/A INTRINSIC
C2 369 467 1.51e-1 SMART
PH 492 596 2.94e-11 SMART
DUF1041 801 902 7.2e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166458
AA Change: E98D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125972
Gene: ENSMUSG00000017978
AA Change: E98D

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
coiled coil region 236 256 N/A INTRINSIC
C2 340 438 1.51e-1 SMART
PH 463 567 2.94e-11 SMART
DUF1041 772 873 1.05e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium-dependent activator of secretion (CAPS) protein family, which are calcium binding proteins that regulate the exocytosis of synaptic and dense-core vesicles in neurons and neuroendocrine cells. Mutations in this gene may contribute to autism susceptibility. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in cerebellum, Purkinje cell and interneuron morphology, paired-pulse facilitation, and behaviors including emotional behavior, vestibuoocular reflex, circadium and sleep patterns, social investigation and nurturing behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810037I17Rik G A 3: 122,924,625 A56T probably benign Het
2310050C09Rik C T 3: 92,868,644 G244D probably benign Het
4930438A08Rik A T 11: 58,287,470 I119F Het
Abca12 A T 1: 71,293,440 I1254N probably damaging Het
Abcb11 G T 2: 69,308,465 Y157* probably null Het
Adcy7 G A 8: 88,318,047 probably null Het
Adnp A G 2: 168,184,878 Y166H probably damaging Het
Adprhl1 A G 8: 13,225,279 V493A probably benign Het
Ahctf1 T C 1: 179,784,120 T562A probably benign Het
Amotl1 T A 9: 14,593,024 N296I possibly damaging Het
Ankar A G 1: 72,674,051 V693A probably benign Het
Ankrd16 T C 2: 11,781,507 V189A probably benign Het
Bmp1 A G 14: 70,519,898 L47P probably benign Het
Cacna2d4 A G 6: 119,271,515 D429G probably benign Het
Cd109 A T 9: 78,669,760 I580F possibly damaging Het
Cdrt4 T A 11: 62,951,298 I2N unknown Het
Cep250 C T 2: 155,970,122 A446V unknown Het
Chuk A T 19: 44,107,350 W15R probably damaging Het
Cpvl C T 6: 53,974,794 M1I probably null Het
Cyfip1 A G 7: 55,900,010 M642V probably damaging Het
Dhh T A 15: 98,897,876 R133* probably null Het
Dnmt3b G A 2: 153,666,060 V212M probably benign Het
Dync2li1 A G 17: 84,649,709 S301G probably benign Het
Epas1 A C 17: 86,826,562 I500L possibly damaging Het
Ephb4 A T 5: 137,354,562 I136F possibly damaging Het
Foxg1 T C 12: 49,384,537 F18L unknown Het
Frem1 T C 4: 83,001,820 E432G probably damaging Het
Gm5591 T A 7: 38,528,061 M1L probably benign Het
Gpld1 A T 13: 24,952,917 S73C probably damaging Het
Hddc3 A G 7: 80,343,580 I52V probably benign Het
Hmgcll1 A T 9: 76,084,450 T252S probably damaging Het
Igsf10 G A 3: 59,336,422 R164W probably damaging Het
Jph2 A G 2: 163,338,686 V675A probably benign Het
Kifap3 T C 1: 163,862,097 F550S probably benign Het
Klk15 C T 7: 43,938,366 H73Y possibly damaging Het
L1td1 T C 4: 98,737,695 V643A possibly damaging Het
L3mbtl3 C T 10: 26,336,257 M255I unknown Het
Layn T A 9: 51,057,537 D302V probably damaging Het
Lpcat4 A G 2: 112,242,073 I136V possibly damaging Het
Lrp1 T A 10: 127,546,938 D3658V probably damaging Het
Metap1d T C 2: 71,522,556 L243S possibly damaging Het
Midn T A 10: 80,154,441 H315Q probably damaging Het
Myb C T 10: 21,154,713 D62N probably benign Het
Myh2 T C 11: 67,186,696 S886P probably benign Het
Nemf T C 12: 69,341,319 I396V probably damaging Het
Nemp1 T G 10: 127,689,358 V127G possibly damaging Het
Nkx3-1 C T 14: 69,190,778 T25M possibly damaging Het
Nmral1 A C 16: 4,713,767 L208R probably damaging Het
Nol6 A T 4: 41,116,422 I989N probably benign Het
Olfr1126 T A 2: 87,457,563 C133S possibly damaging Het
Palld A T 8: 61,720,537 S363T probably damaging Het
Pcdha11 A G 18: 37,011,459 D201G probably damaging Het
Per2 A G 1: 91,438,359 C339R probably damaging Het
Phactr4 T C 4: 132,370,563 T455A possibly damaging Het
Phc2 T C 4: 128,723,269 I445T probably damaging Het
Polr1a T C 6: 71,954,771 F945L probably damaging Het
Ppp2r5e T A 12: 75,593,289 K13* probably null Het
Ptafr T C 4: 132,579,302 M1T probably null Het
Rbms1 G A 2: 60,779,743 P208S probably benign Het
Scg3 T A 9: 75,651,673 I419F probably damaging Het
Scn1a T C 2: 66,299,755 T219A probably benign Het
Sec14l4 A G 11: 4,039,977 D92G probably damaging Het
Senp3 G T 11: 69,678,259 Q359K probably damaging Het
Sirt1 T C 10: 63,337,078 D142G probably damaging Het
Skint2 T C 4: 112,625,842 M148T possibly damaging Het
Skiv2l2 A T 13: 112,914,354 probably null Het
Slc30a10 T A 1: 185,455,194 M44K probably damaging Het
Snai2 T A 16: 14,706,928 D99E probably damaging Het
Spg7 A G 8: 123,080,669 K395E possibly damaging Het
Sphk2 G A 7: 45,710,913 H556Y possibly damaging Het
Supt6 A C 11: 78,225,786 F637L probably benign Het
Tcam1 A G 11: 106,286,466 N428S probably damaging Het
Tctn3 C T 19: 40,608,248 R276K probably benign Het
Timm29 G A 9: 21,593,360 R108H probably damaging Het
Tlr9 A T 9: 106,225,553 E681V possibly damaging Het
Tmco1 C T 1: 167,308,563 probably benign Het
Tns3 T C 11: 8,450,094 K1169E probably damaging Het
Trim72 A C 7: 128,009,143 D271A possibly damaging Het
Trpv4 A T 5: 114,634,561 D369E probably benign Het
Ttn A G 2: 76,752,848 L22567P probably damaging Het
Uimc1 G A 13: 55,075,839 P207S probably damaging Het
Unc5d A T 8: 28,675,420 V781E probably damaging Het
Upk3bl C T 5: 136,057,222 P4L unknown Het
Vmn1r201 A G 13: 22,475,500 N295D probably benign Het
Vmn2r69 A G 7: 85,415,489 I63T probably benign Het
Zfyve28 T C 5: 34,217,444 T409A probably benign Het
Other mutations in Cadps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Cadps2 APN 6 23496874 missense possibly damaging 0.84
IGL01105:Cadps2 APN 6 23321700 splice site probably benign
IGL01317:Cadps2 APN 6 23314173 missense possibly damaging 0.76
IGL01409:Cadps2 APN 6 23587441 missense probably damaging 1.00
IGL01477:Cadps2 APN 6 23263673 missense probably damaging 1.00
IGL01620:Cadps2 APN 6 23587462 missense probably benign 0.19
IGL01674:Cadps2 APN 6 23355852 missense probably damaging 1.00
IGL01675:Cadps2 APN 6 23382905 missense probably damaging 1.00
IGL01895:Cadps2 APN 6 23427275 missense probably damaging 0.98
IGL02095:Cadps2 APN 6 23427310 missense probably benign 0.01
IGL02200:Cadps2 APN 6 23385528 missense probably damaging 1.00
IGL02380:Cadps2 APN 6 23287732 missense probably benign 0.11
IGL02680:Cadps2 APN 6 23838896 missense probably damaging 0.99
IGL02814:Cadps2 APN 6 23321707 missense probably damaging 1.00
IGL02940:Cadps2 APN 6 23496809 missense probably benign 0.08
IGL03061:Cadps2 APN 6 23287660 splice site probably null
IGL03233:Cadps2 APN 6 23263601 missense probably benign 0.10
R0193:Cadps2 UTSW 6 23599440 missense probably benign 0.00
R0389:Cadps2 UTSW 6 23321782 missense possibly damaging 0.88
R0571:Cadps2 UTSW 6 23583412 missense probably damaging 1.00
R0595:Cadps2 UTSW 6 23321704 critical splice donor site probably null
R0620:Cadps2 UTSW 6 23583396 missense probably damaging 1.00
R0723:Cadps2 UTSW 6 23287698 missense probably damaging 0.99
R0831:Cadps2 UTSW 6 23321740 missense possibly damaging 0.88
R0836:Cadps2 UTSW 6 23328776 splice site probably benign
R0942:Cadps2 UTSW 6 23263562 missense probably damaging 1.00
R1099:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R1120:Cadps2 UTSW 6 23838794 missense probably damaging 1.00
R1216:Cadps2 UTSW 6 23583473 splice site probably benign
R1575:Cadps2 UTSW 6 23429218 missense probably damaging 1.00
R1780:Cadps2 UTSW 6 23320932 critical splice donor site probably null
R1924:Cadps2 UTSW 6 23688858 missense probably damaging 0.99
R1944:Cadps2 UTSW 6 23599480 missense probably damaging 0.99
R1956:Cadps2 UTSW 6 23287686 missense probably damaging 1.00
R1986:Cadps2 UTSW 6 23323380 missense probably damaging 1.00
R2045:Cadps2 UTSW 6 23839122 missense possibly damaging 0.73
R2146:Cadps2 UTSW 6 23838999 intron probably benign
R2147:Cadps2 UTSW 6 23838999 intron probably benign
R2148:Cadps2 UTSW 6 23838999 intron probably benign
R2150:Cadps2 UTSW 6 23838999 intron probably benign
R2219:Cadps2 UTSW 6 23410832 missense probably damaging 1.00
R2264:Cadps2 UTSW 6 23323340 missense probably benign 0.15
R2338:Cadps2 UTSW 6 23838978 splice site probably benign
R3861:Cadps2 UTSW 6 23355861 missense probably damaging 1.00
R3898:Cadps2 UTSW 6 23528126 missense probably damaging 1.00
R3982:Cadps2 UTSW 6 23263531 utr 3 prime probably benign
R4213:Cadps2 UTSW 6 23599463 missense probably damaging 1.00
R4384:Cadps2 UTSW 6 23412988 missense probably benign 0.18
R4432:Cadps2 UTSW 6 23626738 missense probably damaging 0.99
R4609:Cadps2 UTSW 6 23587579 missense probably damaging 1.00
R4806:Cadps2 UTSW 6 23688860 missense probably damaging 0.96
R4977:Cadps2 UTSW 6 23599479 missense probably damaging 1.00
R5174:Cadps2 UTSW 6 23287743 missense probably damaging 1.00
R5267:Cadps2 UTSW 6 23626668 missense possibly damaging 0.79
R5389:Cadps2 UTSW 6 23329104 missense probably damaging 1.00
R5737:Cadps2 UTSW 6 23328805 missense probably benign 0.28
R6074:Cadps2 UTSW 6 23626671 missense probably damaging 1.00
R6254:Cadps2 UTSW 6 23329163 critical splice acceptor site probably null
R6323:Cadps2 UTSW 6 23263578 missense probably benign 0.04
R6463:Cadps2 UTSW 6 23323334 nonsense probably null
R6907:Cadps2 UTSW 6 23599506 missense probably damaging 1.00
R6940:Cadps2 UTSW 6 23302492 missense probably damaging 1.00
R6964:Cadps2 UTSW 6 23583459 missense probably damaging 1.00
R7079:Cadps2 UTSW 6 23323409 missense probably damaging 1.00
R7139:Cadps2 UTSW 6 23410889 missense probably damaging 1.00
R7156:Cadps2 UTSW 6 23688956 missense probably benign 0.02
R7184:Cadps2 UTSW 6 23583429 missense probably benign 0.18
R7325:Cadps2 UTSW 6 23409935 missense unknown
R7526:Cadps2 UTSW 6 23496851 missense probably damaging 1.00
R7546:Cadps2 UTSW 6 23626608 missense probably benign 0.15
R7772:Cadps2 UTSW 6 23390446 missense probably benign 0.00
R7870:Cadps2 UTSW 6 23263642 missense probably benign 0.14
R8040:Cadps2 UTSW 6 23412943 splice site probably benign
R8048:Cadps2 UTSW 6 23838863 missense probably benign 0.14
R8082:Cadps2 UTSW 6 23323314 missense probably damaging 1.00
R8100:Cadps2 UTSW 6 23838809 missense probably damaging 1.00
R8115:Cadps2 UTSW 6 23328898 missense probably benign 0.00
R8497:Cadps2 UTSW 6 23355919 missense probably benign 0.27
R8768:Cadps2 UTSW 6 23382939 missense probably damaging 1.00
R8783:Cadps2 UTSW 6 23302304 missense possibly damaging 0.57
R8804:Cadps2 UTSW 6 23496806 missense probably damaging 1.00
R8832:Cadps2 UTSW 6 23587537 missense possibly damaging 0.52
R8848:Cadps2 UTSW 6 23344257 missense probably damaging 1.00
R8854:Cadps2 UTSW 6 23385508 missense probably damaging 1.00
R8896:Cadps2 UTSW 6 23410877 missense probably damaging 1.00
R8910:Cadps2 UTSW 6 23344224 missense probably benign 0.11
R8921:Cadps2 UTSW 6 23302301 missense probably benign 0.00
R9297:Cadps2 UTSW 6 23496888 missense probably benign
R9318:Cadps2 UTSW 6 23496888 missense probably benign
R9348:Cadps2 UTSW 6 23344263 missense probably benign 0.20
R9447:Cadps2 UTSW 6 23323298 missense probably damaging 0.96
Z1176:Cadps2 UTSW 6 23321801 missense probably benign 0.24
Z1177:Cadps2 UTSW 6 23385478 missense possibly damaging 0.88
Z1177:Cadps2 UTSW 6 23626695 missense probably damaging 1.00
Z1177:Cadps2 UTSW 6 23838818 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCTCAAAACCAGGCTGTG -3'
(R):5'- GACTACAAAGGTAATTCGGTGTC -3'

Sequencing Primer
(F):5'- TGCAAAATAGAAGCGAAATCCTTTGG -3'
(R):5'- CGGTGTCTAATCAAATTTACATCGC -3'
Posted On 2022-02-07